Search Results for:

Students can Download Computer Applications Chapter 8 Forms and Files Questions and Answers, Notes Pdf, Samacheer Kalvi 12th Computer Applications Book Solutions Guide Pdf helps you to revise the complete Tamilnadu State Board New Syllabus and score more marks in your examinations.

Tamilnadu Samacheer Kalvi 12th Computer Applications Solutions Chapter 8 Forms and Files

Samacheer Kalvi 12th Computer Applications Forms and Files Text Book Back Questions and Answers

PART – I
I. Choose The Correct Answer

Question 1.
When you use the $_GET variable to collect data, the data is visible to..
(a) none
(b) only you
(c) everyone
(d) selected few
Answer:
(c) everyone

Question 2.
Which one of the following should not be used while sending passwords or other sensitive information?
(a) GET
(b) POST
(c) REQUEST
(d) NEXT
Answer:
(a) GET

Question 3.
Which directive determines whether PHP scripts on the server can accept file uploads?
(a) file_uploads
(b) fileupload
(c) filejnput
(d) file_intake
Answer:
(a) file_uploads

Question 4.
In HTML form <input type=”text”> is used for …………………………..
(a) One line text
(b) Block of text
(c) One paragraph
(d) None
Answer:
(a) One line text

Question 5.
HTML classes that is already defined and allow us to apply styles on it are called as ………………………….
(a) Pseudo classes
(b) Css classes
(c) Javascript classes
(d) Nre
Answer:
(b) Css classes

Question 6.
If you would like to read a file character by character which function do you use?
(a) fopen( )
(b) fread( )
(c) fgetc( )
(d) fleo
Answer:
(c) fgetc( )

Question 7.
PHP is a ……………………….. typed language.
(a) User
(b) Loosely
(c) Server
(d) System
Answer:
(c) Server

Question 8.
What does fopen( ) function do in PHP?
(a) It used to open files in PHP
(b) It used to open Remote Server
(c) It used to open folders in PI-IP
(d) It used to open Remote Computer
Answer:
(b) It used to open Remote Server

Question 9.
How PHP files can be accessed?
(a) Through Web Browser
(b) Through HTML files
(c) Through Web Server
(d) All of Above
Answer:
(d) All of Above

Question 10.
Which of the following functions reads the entire contents of a file?
(a) fgets( )
(b) file_get_contents( )
(c) fread( )
(d) readfile( )
Answer:
(b) file_get_contents( )

PART – II
II. Short Answer

Question 1.
Define HTML form controls?
Answer:
Main objective of PHP and HTML form controls are to collect data from users. The various form controls are

1. Text inputs
2. Checkbox
3. File Select
   • Buttons
   • Radio box
   • FormTag

Question 2.
Define for Form Handling method in PHP?
Answer:

1. Form tag is used to mention a method (POST or GET) and control the entire form controls in the HTML document.
2. All input values are synchronized and sent to the server via POST or GET method.

Question 3.
What is Form Validation in PHP?
Answer:

1. Validation is a process of checking the input data submitted by the user from client machine.
2. There are two types of validation available in PHP. They are as follows, Client-Side Validation, Server Side Validation.

Question 4.
List out HTML control to support PHP language?
Answer:
Basic HTML Form Controls
The following control types are available in HTML form controlling:

1. Text inputs
2. Checkbox
3. File Select
4. Buttons
5. Radio box
6. Form Tag

Text inputs contain textbox and text area controls. Buttons may contain Submit button, Reset button and Cancel Button.

Question 5.
Write Syntax of Text box in HTML?
Answer:
Name: <input type-‘text” name=“name”><br>
E-mail: <input type=“texf ’ name=“email”><br>

Question 6.
Define File handling in PHP?
Answer:
Files
File handling is an important activity of all web application development process. Files are processed for different tasks using the following events:

1. PHP Open a File
2. PHP Read a File
3. PHP Close a File
4. PHP Write a File
5. PHP Appending a File and
6. PHP uploading a File.

Question 7.
Define Browse button in HTML?
Answer:
Browse Button in HTML:

1. In the <Input> tag mention type = “file” attribute shows the input field as a file-select control, with a “Browse” button next to the input control.
2. Browse button is used to search for any file or websites.

Question 8.
Write Syntax of Browse button in HTML?
Answer:
Syntax:
<input type = file name = browse>

Question 9.
Compare Text box and Text Area?
Answer:
Text Box:

1. Text Box is a single line box
2. Text boxes are generally used for collecting information such as names, email addresses.

Text Area:

1. Text area is a multiple line box
2. Text area’s are generally used to gather feedback or comments.
3. It has a limit of 32700 characters.

Question 10.
Usage of File open function?
Answer:

1. fopen( ) is a system function available in PHP.
2. This function helps to open a file in the server.
3. It contains two parameters one for the file and the other one specifies in which mode the file should be opened (Read/Write).

PART – III
III. Explain in Brief Answer

Question 1.
Write the features Form Handling?
Answer:
Form Handling:

1. Form controls are used to collect data from the users and sent to server.
2. When the user keying the input data in HTML controls and clicks the submit button the request will be generated and reaches a PHP file which is mentioned in the FORM tag under the Action attribute.
3. All input values are synchronized and sent to the server via POST method or GET method.
4. Once the data reaches the server, two PHP variables such as $_POST and $_GET collects – the data and prepares the response accordingly.

Question 2.
Write the purpose Get method and Post method?
Answer:
All input values are synchronized and sent to the server via POST method or GET method. Method is an attribute form tag in HTML. Once the data reaches the server, two PHP variables such as $_POST and $_GET collects the data and prepares the response accordingly.

Post Method:
The input data sent to the server with POST method is stored in the request body of the client’s HTTP request.

Get Method:
The input data sent to the server with POST method via URL address is known as query string. All input data are visible by user after they clicks the submit button.

Question 3.
Differentiate Get and Post Method?
Answer:
Get Method:

1. It is used to send data through URL address.
2. All the input data are visible.
3. It is faster.
4. It is less secure.

Post Method:

1. It is send through clients HTTP request.
2. It is not visible.
3. It is little slow.
4. It is secured.

Question 4.
Write short notes on File handling?
Answer:

1. File handling is an important activity of all web application development process.
2. Files are processed for different tasks using the following events:
   1. Opening a file
   2. Reading a file
   3. closing a file
   4. To write a file
   5. To append a file
   6. To upload a file

Question 5.
Write short notes on File handling functions?
Answer:

1. fopen( ) – PHP Open a File
2. fread( ) – PHP Read a File,
3. fclose( ) – PHP Close a File,
4. fwrite( ) – PHP Write a File,
5. file_put_contents( ) – PHP Appending a File

PART – IV
IV. Explain in detail

Question 1.
Explain Form Handling methods?
Answer:
PHP Basic Form Handling:

1. When the user keying the input data in HTML controls and clicks the submit button the request will be generated and reaches a PHP file which is mentioned in the FORM tag under the Action attribute.
2. All input values are synchronized and sent to the server via POST method or GET method.
3. Method is an attribute form tag in HTML. Once the data reaches the server, two PHP variables such as $_POST and $_GET collects the data and prepares the response accordingly.

Post Method:
The input data sent to the server with POST method is stored in the request body of the client’s HTTP request.

Get Method:
The input data sent to the server with POST method via URL address is known as query string. All input data are visible by user after they clicks the submit button.
Example:
Test.html:
<htnjl>
<body>
<form action=“welcome.php” method=“posf’>
Name: <input type=“text” name=“name”><br>
E-mail: <input type=“text” name=“email”><br>
<input type=“submif’>
</form>
</body>
</html>
Welcome.php:
<html>
<body>
Welcome <?php echo $_POST[“name”]; ?><br>
Your email address is: <?php echo $_POST[“email”]; ?>
</body>
</html>

• HTML File contains two Text Box (Name and Email), One Button and one form tag. The remote server PHP file (welcome.php) is mentioned in form tag under the Action Attribute.
• In “Welcome.Php” file, PHP variables such as $_POST and SGET collects the data and prepares the response accordingly.
• Eventually the user will receive the output response in the client machine’s browser screen.

Question 2.
Discuss in detail about HTML form controls?
Answer:
Basic HTML Form Controls
The following control types are available in HTML form controlling:

1. Text inputs
2. Buttons
3. Checkbox
4. Radio box
5. File Select
6. Form Tag

1. Text inputs contain textbox and text area controls.
2. Buttons may contain Submit button, Reset button and Cancel Button.
3. Checkbox is the important feature which selects more than one value from the HTML form.
4. Radio box is similar to checkbox but one value can be chosen at a time.
5. File select is the best feature to select one file from the local machine to server machine at a time.
6. Form tag is used to mention a method (POST or GET) and control the entire form controls in the HTML document

Question 3.
Explain the process File handling?
Answer:
File handling is an important activity of all web application development process. Files are processed for different tasks using the following events:

1. PHP Open a File,
2. PHP Read a File,
3. PHP Close a File,
4. PHP Write a File,
5. PHP Appending a File and
6. PHP uploading a File.

1. Open a File:
fopen( ) is a system function available in PHP. This function helps to open a file in the server. It contains two parameters one for the file and the other one specifies in which mode the file should be opened (Read/Write).
Syntax:
$file_Object= fopen(“FileName”, “Read/WriteMode”) or die(“Error Message!”);
Example:
<?php
Smyfile = fopen(“Student.txt’’, “r”) or die(“Unable to open file!”);
?>

2. Read a File:
The fread( ) function reads from an open file. The file object comes from fopen function.
Syntax:
ffead($file_Object,filesize(“FileName”));
Example:
<?php
fread($myfile,filesize(“Student.txt”));
?>

3. Close a File:
The fclose( ) function is used to close an opened file. The file object comes from fopen function.
Syntax:
fclose($file_Object);
Example:
fclose($myfile)

4. write a File:
The fwrite( ) function is used to write to a file.
Syntax:
fwrite($myfile, $txt);
Example:
fwrite($myfile, $txt)

5. Appending a File
The file_put_contents( ) function is used to Append to a file. The various parameters used in appending a file are
Syntax:
file_put_contents(file, data, mode, context)

6. File Upload:

1. File upload is the best feature to select one file from the local machine to server machine.
2. Form tag is used to mention a method as POST or GET and encrypt attribute mentioned as “multipart/form-data”.
3. In the <Input> tag mention type=”file” attribute shows the input field as a file-select control, with a “Browse” button next to the input control. The form above sends data to a file called “Student_photo_upload.php”.
4. First, ensure that PHP is configured to allow file uploads.
5. In Server machine “php.ini” file, search for the file_uploads directive, and set it to On:
   “file_upIoads = On”

Question 4.
Explain concepts of HTTP Uploading process?
Answer:
File Upload:
1. File upload is the best feature to select one file from the local machine to server.machine. Form tag is used to mention a method as POST or GET and encrypt attribute mentioned as “multipart/form-data”.

2. In the <Input> tag mention type=”file” attribute shows the input field as a file-select control, with a “Browse” button next to the input control.

3. The form above sends data to a file called “Student_photo_upload.php”.

4. First, ensure that PHP is configured to allow file uploads.

5. In Server machine “php.ini” file, search for the file_uploads directive, and set it to On:
“file_upIoads = On”

6. After submitting the upload button the request reaches to Student_photo_upload.php file. In the file $_FILES variable collects all uploaded file information such as name of the file, size of the file and extension of the file etc.

7. All the details are checked thoroughly and the errors are saved in an array variable.

8. The file finally moves under the image directory if the array error variable is empty.

Question 5.
Explain in detail of File handling functions?
Answer:
File handling is an important activity of all web application development process. Files are processed for different tasks using the following events:

1. PHP Open a File,
2. PHP Read a File,
3. PHP Close a File,
4. PHP Write a File,
5. PHP Appending a File and
6. PHP uploading a File.

1. Open a File
fopen( ) is a system function available in PHP. This function helps to open a file in the server. It contains two parameters one for the file and the other one specifies in which mode the file should be opened (Read/Write).
Syntax:
$file_Object= fopen(“FileName”, “Read/WriteMode”) or die(“Error Message!”);
Example:
<?php
$myfile = fopen(“Student.txf’, “r”) or die(“Unable to open file!”);
?>

2. Read a File:
The ffead( ) function reads from an open file. The file object comes from fopen function.
Syntax:
fread($file_Object,filesize(“FileName”));
Example:
<?php
fread($myfile,filesize(“Student,txt”));
?>

3. Close a File:
The fclose( ) function is used to close an opened file. The file object comes from fopen function.
Syntax:
fclose($file_Object);
Example:
fclose($myfile);

4. write a File:
The fwrite( ) function is used to write to a file.
Syntax:
fwrite($myfile, $txt);
Example:
fwrite($myfile, $txt);

5. Appending a File
The file_put_contents( ) function is used to Append to a file. The various parameters used in appending a file.
file_put_contents (file, data, mode, context)

6. File Upload:
1. File upload is the best feature to select one file from the local machine to server machine.
Form tag is used to mention a method as POST or GET and encrypt attribute mentioned as “multipart/form-data”.

2. In the <Input> tag mention type=“file” attribute shows the input field as a file-select control, with a “Browse” button next to the input control. The form above sends data to a file called “Student_photo_upload.php”.
Note: First, ensure that PHP is configured to allow file uploads.

3. In Server machine “php.ini” file, search for the file_uploads directive, and set it to On:
“fileuploads = On”

Samacheer Kalvi 12th Computer Applications Solutions Forms and Files Additional Question and Answer

1. Choose the Best Answer

Question 1.
………………………… inputs contain text box and text area controls.
Answer:
Text

Question 2.
Pick the odd one out.
(a) Submit
(b) Reset
(c) File
(d) Cancel
Answer:
(c) File

Question 3.
Which one of the control selects more than one value from the HTML form?
Answer:
(a) Checkbox
(b) Reset
(c) Buttons
(d) Text
Answer:
(a) Checkbox

Question 4.
…………………………. is used to select one value can be chosen at a time.
(a) Checkbox
(b) Radio box
(c) Textbox
(d) File
Answer:
(b) Radio box

Question 5.
Which is the best feature to select one file from the local machine to server machine at a time?
(a) Radio box
(b) Check box
(c) File select
(d) Textbox
Answer:
(c) File select

Question 6.
Find the Incorrect pair.
(a) Radio box – one value a time
(b) File select – Select one file from local machine to server
(c) Text – Text Box
(d) Input – Text Area
Answer:
(d) Input – Text Area

Question 7.
Which tag is used to mention POST or GET method?
(a) Frame
(b) Form
(c) File
(d) Input
Answer:
(b) Form

Question 8.
…………………………. is an attribute of form tag in HTML.
(a) post
(b) Get
(c) method
(d) php get
Answer:
(c) method

Question 9.
In get method, the input data sent URL address is known as …………………………….
Answer:
query string

Question 10.
………………………. is a process of checking the input data submitted by the user from client machine.
(a) collection
(b) verification
(c) validation
(d) Report
Answer:
(c) validation

Question 11.
How many types of validation are available in PHP?
(a) 1
(b) 2
(c) 3
(d) 4
Answer:
(b) 2

Question 12.
The two types of validation are ………………………. and …………………………. validation.
Answer:
client side and server-slide

Question 13.
Pick the odd one out
(a) PHP
(b) JS
(c) JSP
(d) ASP
Answer:
(b) JS

Question 14.
Find the statement which is true.
(a) The input data validations are performed on the clients machine’s web browser
(b) The input data validations are performed on the server machine
Answer:
(a) The input data validations are performed on the clients machine’s web browser

Question 15.
The “required” attributed in HTML input tags are present in ………………………. validation.
(a) server side
(b) client side
(c) PHP script
(d) script code
Answer:
(b) client side

Question 16.
Which one of the following is not an back-end application?
(a) CGI
(b) HTML
(c) ASP Script
(d) PHP Script
Answer:
(b) HTML

Question 17.
How many parameters are there in fopen( ) functions?
(a) 1
(b) 2
(c) 3
(d) 4
Answer:
(b) 2

Question 18.
The …………………………… function reads from an open file.
Answer:
fread( )

Question 19.
Which function is used to append to a file?
(a) fread( )
(b) fopen( )
(c) file_put_contents( )
(d) fwrite( )
Answer:
(c) file_put_contents( )

Question 20.
How many parameters are there in file_put_contents( ) function?
(a) 2
(b) 3
(c) 4
(d) 5
Answer:
(c) 4

Question 21.
How many parameters are required and options in the file_put_contents( )?
(a) 1,2
(b) 2,2
(c) 3,2
(d) 2,1
Answer:
(b) 2,2

Question 22.
The data to be written to the file cannot be …………………………….
(a) string
(b) pointers
(c) array
(d) data stream
Answer:
(b) pointers

Question 23.
………………….. is set of options in append that can modify the behaviour of a stream.
(a) file
(b) data
(c) mode
(d) context
Answer:
(d) context

Question 24.
In the file $_FILES variable collect all uploaded file information such as
(a) name of the file
(b) size of the file
(c) extension of the file
(d) all the above
Answer:
(d) all the above

Question 25.
The file finally moves under the ……………………… directory if the array error variable is empty.
(a) image
(b) post
(c) get
(d) file
Answer:
(a) image

Question 26.
AJAX me ……………………………………..
Answer:
Asynchronous Javascript

Question 27.
AJAX uses ………………………… to display the data.
Answer:
HTML DOM

II. Short Answer

Question 1.
Give the syntax for fopen( ) function?
Answer:
Syntax:
$file_Object= fopen(“FileName”, “ReadAVriteMode”) or die(“Error Message!”);

Question 2.
Give the syntax for fread( ) function?
Answer:
Syntax:
fread($file_Object,filesize(“FileName”));

III. Explain in Brief Answer

Question 1.
Write note on client-side validation?
Answer:
Client-Side Validation: The input data validations are performed on the client machine’s web browsers using client side scripts like Java script or adding “required” attribute in HTML input tags.

Question 2.
What is meant by Server side validation?
Answer:
Server Side Validation: After the submission of data, validations are performed on the server side using the programming like PHP, ASP or JSP etc. available in the server machine.

Question 3.
Write a code to do validation in client side?
Answer:
Example:
<input> required Attribute in HTML <form action=“welcome.php”>
Username: <input type=“text” name=“name” required>
<input type=“submit”>
</form>

Question 4.
Give the syntax for fclose( ) function?
Answer:
Syntax:
fclose($file_Objecdt):

Question 5.
Explain various parameters used in appending the file?
Answer:

IV. Explain in detail

Question 1.
Write a HTML program to produce the following output?

Test.html:
<html>
<body>
<form action=“welcome.php” method=“post”>
Name: <input type=“text” name=“name”><br>
E-mail: <input type=“text” name=“email”><br>
<input type=“siibmit”>
</form>
</body>
– </html>
Welcome.php:
<html>
<body>
Welcome <?php echo $_POST[“name”]; ?><br>
Your email address is: <?php echo $_POST[“email”]; ?> </body>
</html>

Question 2.
Explain how to append a file in PHP?
PHP Appending a File
Answer:
The file_put_contents( ) function is used to Append to a file.
Syntax:
file_put_contents(file, data, mode, context)

Example:
<?php
$txt = “Student id”;
Smyfile = file_put_contents(Togs.txt’, $txt.
PHP EOL, FILEAPPEND | LOCK_EX);
?>

Students can Download Bio Zoology Chapter 7 Human Health and Diseases Questions and Answers, Notes Pdf, Samacheer Kalvi 12th Bio Zoology Book Solutions Guide Pdf helps you to revise the complete Tamilnadu State Board New Syllabus and score more marks in your examinations.

Tamilnadu Samacheer Kalvi 12th Bio Zoology Solutions Chapter 7 Human Health and Diseases

Samacheer Kalvi 12th Bio Zoology Human Health and Diseases Text Book Back Questions and Answers

Question 1.
A 30 year old woman has bleedy diarrhoea for the past 14 hours, which one of the following organisms is likely to cause this illness?
(a) Streptococcus pyogens
(b) Clostridium difficile
(c) Shigella dysenteriae
(d) Salmonella enteritidis
Answer:
(c) Shigella dysenteriae

Question 2.
Exo-erythrocytic schizogony of Plasmodium takes place in __________
(a) RBC
(b) Leucocytes
(c) Stomach
(d) Liver
Answer:
(d) Liver

Question 3.
The sporozoites of Plasmodium vivax are formed from __________
(a) Gametocytes
(b) Sporoblasts
(c) Oocysts
(d) Spores
Answer:
(c) Oocysts

Question 4.
Amphetamines are stimulants of the CNS, whereas barbiturates are __________
(a) CNS stimulant
(b) both a and b
(c) hallucinogenic
(d) CNS depressants
Answer:
(d) CNS depressants

Question 5.
Choose the correctly match pair.
(a) Amphetamines – Stimulant
(b) LSD-Narcotic
(c) Heroin – Psychotropic
(d) Benzodiazepine – Pain killer
Answer:
(a) Amphetamines – Stimulant

Question 6.
The Athlete’s foot disease in human is caused by __________
(a) Bacteria
(b) Fungi
(c) Virus
(d) Protozoan
Answer:
(b) Fungi

Question 7.
Cirrhosis of liver is caused by chronic intake of __________
(a) Opium
(b) Alcohol
(c) Tobacco
(d) Cocaine
Answer:
(b) Alcohol

Question 8.
The sporozoite of the malarial parasite is present in __________
(a) saliva of infected female Anopheles mosquito.
(b) RBC of human suffering from malaria.
(c) Spleen of infected humans.
(d) Gut of female Anopheles mosquito
Answer:
(a) saliva of infected female Anopheles mosquito.

Question 9.
Where do the following events in the life cycle of Plasmodium takes place?
(a) Fertilization – __________
(b) Development of gametocytes – __________
(c) Release of sporozoites – __________
(d) Schizogony – __________
Answer:
(a) Fertilization – Gut of mosquito
(b) Development of gametocytes – Human RBC’s
(c) Release of sporozoites – From Mosquito to the human blood
(d) Schizogony – Human liver cells

Question 10.
Paratope is an __________
(a) Antibody binding site on variable regions
(b) Antibody binding site on heavy regions
(c) Antigen binding site on variable regions
(d) Antigen binding site on heavy regions
Answer:
(c) Antigen binding site on variable regions

Question 11.
Allergy involves __________
(a) IgE
(b) IgG
(c) IgA
(d) IgM
Answer:
(a) IgE

Question 12.
Spread of cancerous cells to distant sites is termed as __________
(a) Metastasis
(b) Oncogenes
(c) Proto-oncogenes
(d) Malignant neoplasm
Answer:
(a) Metastasis

Question 13.
AIDS virus has __________
(a) Single stranded RNA
(b) Double stranded RNA
(c) Single stranded DNA
(d) Double stranded DNA
Answer:
(a) Single stranded RNA

Question 14.
B cells that produce and release large amounts of antibody are called __________
(a) Memory cells
(b) Basophils
(c) Plasma cells
(d) killer cells
Answer:
(c) Plasma cells

Question 15.
Given below are some human organs.
Answer:
Primary lymphoid organ – thymus
Secondary lymphoid organ – tonsils
Immunocompetency of T cells is achieved in Thymus
Whereas tonsils help to fight viral and bacterial infections.

Question 16.
Name and explain the type of barriers which involve macrophages.
Answer:
Phagocytic barriers involves macrophages (monocytes, neutrophils) which phagocytose and . digest whole micro organisms.

Question 17.
What are interferons? Mention their role.
Answer:
Interferons are the antiviral proteins which induce antiviral state in the infected cells.

Question 18.
List out chemical alarm signals produced during inflammation.
Answer:
Serotonin, histamine and prostaglandins.

Question 19.
Explain the process of replication of retrovirus after it gains entry into the human body.
Answer:
After getting into the body of the person, the retrovirus enters into macrophages where RNA genome of the virus replicates to form viral DNA with the help of the enzyme reverse transcriptase. This viral DNA gets incorporated into the DNA of host cells and directs the infected cells to produce viral particles. The macrophages continue to produce virus and in this way acts like an HIV factory.

Question 20.
Explain the structure of immunoglobulin with suitable diagram.
Answer:
An antibody molecule is a Y-shaped structure that comprises of four polypeptide chains, two identical light chains (L) of molecular weight 25,000 Da (approximately 214 amino acids) and two identical heavy chains (H) of molecular weight 50,000 Da (approximately 450 amino acids). The polypeptide chains are linked together by di-sulphide (S-S) bonds. One light chain is attached to each heavy chain and two heavy chains are attached to each other to form a Y shaped structure. Hence, an antibody is represented by H₂ L₂ The heavy chains have a flexible hinge region at their approximate middles Antigen binding

Each chain (L and H) has two terminal They are C – terminal (Carboxyl) and amino or N-terminal. Each chain (L and H) has two regions. They have variable (V) region at one end and a much larger constant (C) region at the other end. Antibodies responding to different antigens have very different (V) regions but their (C) regions are the same in all antibodies. In each arm of the monomer antibody, the (V) regions of the heavy and light chains combines to form an antigen-binding

site shaped to ‘fit’ a specific antigenic determinant. Consequently, each antibody monomer has two such antigen-binding regions. The (C) regions that form the stem of the antibody monomer determine the antibody class and serve common functions in all antibodies.

Question 21.
What are the cells involved innate immune system?
Answer:
Cells involved in innate immunity are monocytes (macrophages), neutrophils, helper T-cells, B-cells, dendritic cells.

Question 22.
What is vaccine? What are its types?
Answer:
A vaccine is a biological preparation that provides active acquired immunity to a particular disease and resembles a disease causing microorganism and is often made from weakened or attenuated or killed forms of the microbes, their toxins, or one of its surface proteins. The vaccines are classified as first, second and third-generation vaccines.

Question 23.
A person is infected by HIV. How will you diagnose with AIDS?
Answer:
A simple blood test is available that can determine whether the person has been infected with HIV. The ELISA test (Enzyme-Linked Immunosorbent Assay) detects the presence of HIV antibodies. It is a preliminary test. Western blot test is more reliable and a confirmatory test. It detects the viral core proteins. If both tests detect the presence of the antibodies, the person is considered to be HIV positive.

Question 24.
Autoimmunity is a misdirected immune response. Justify.
Answer:
Autoimmune diseases: Autoimmunity is due to an abnormal immune response in which the immune system fails to properly distinguish between self and non-self and attacks its own body. Our body produces antibodies (autoantibodies) and cytotoxic T cells that destroy our own tissues. If a disease-state results, it is referred to as an auto-immune disease. Thus, autoimmunity is a misdirected immune response.

Question 25.
List the causative agent, mode of transmission and symptoms for Diphtheria and Typhoid
Answer:

Question 26.
A patient was hospitalized with fever and chills. Merozoites were observed in her blood. What is your diagnosis?
Answer:
Appearance of merozoites in a patient’s blood may be an indication of malarial parasite – plasmodium.

Question 27.

1. Write the scientific name of the filarial worm that causes filariasis.
2. Write the symptoms of filariasis.
3. How is this disease transmitted?

Answer:

1. The scientific name of the filarial worm – Wuchereria bancrofti
2. Symptoms of filariasis – Inflammation of lymph nodes, obstruction of lymph vessels causes elephantiasis of limbs, genital etc.
3. Mode of disease transmission: Vector transmission (female Culex mosquito)

Question 28.
List the common withdrawal symptoms of drugs and alcohol abuse.
Answer:
The withdrawal symptoms may range from mild tremors or convulsions, severe agitation and fits, depressed mood, anxiety, nervousness, restlessness, irritability, insomnia, dryness of throat, etc, depending on the type of drug abuse.

Question 29.
Why do you think it is not possible to produce a vaccine against common cold’?
Answer:
Vaccines target specific pathogens and elicit immunity. In case of the common cold, more than 200 strains of viruses are responsible for causing the disease. Hence it is practically difficult to develop a vaccine against it.

Samacheer Kalvi 12th Bio Zoology Human Health and Diseases Additional Questions and Answers

1 – Mark Questions

Question 1.
Pick out the disease which is caused by a virus.
(a) Candidiasis
(b) Ascariasis
(c) Poliomyelitis
(d) Dysentery
Answer:
(c) Poliomyelitis

Question 2.
__________ test is done to confirm typhoid.
(a) ELISA
(b) Western blot
(c) Widal test
(d) Southern blot
Answer:
(c) Widal test

Question 3.
Match the following. Disease

Answer:
(a) a – iv, b – iii, c – i, d- ii

Question 4.
Identify the mismatched pair.

Answer:
(c) Measles – Intestine

Question 5.
Identify the wrong statement regarding polio disease.
(a) Polio is caused by an RNA virus.
(b) One of the infection site of polio is the intestine.
(c) Culex mosquito acts as a vector for polio.
(d) Paralysis and respiratory failure are the symptoms
Answer:
(c) Culex mosquito acts as a vector for polio.

Question 6.
Yellow fever is a __________ type of disease.
(a) Neurotropic
(b) Viscerotropic
(c) Pneumotropic
(d) Dermotropic
Answer:
(b) Viscerotropic

Question 7.
Which one of the following pairs is wrong.
(a) Amoebiasis – Home fly
(b) African sleeping sickness – Tsetse flies
(c) Kala-azar – Sandfly
(d) Malaria – female Anopheles mosquito
Answer:
(d) Malaria – female Anopheles mosquito

Question 8.
__________ is the malignant form of malaria.
Answer:
P. falciparum

Question 9.
Schizogony of plasmodium parasite in human liver cells returns in __________
(a) sporozoites
(b) merozoites
(c) trophozoites
(d) schizont
Answer:
(b) merozoites

Question 10.
Incubation period of malaria is about __________
Answer:
12 days

Question 11.

Answer:
(a) a – iii, b – i, c – iv, d – ii

Question 12.
Assertion (A): Plasmodium vivax is a digenic parasite
Reason (R): The primary host of P. vivax is man.
(a) Both (A) and (R) are true. (R) explains (A)
(b) (A) is true (R) is false
(c) Both (A) and (R) are false
(d) (A) is false (R) is true
Answer:
(b) (A) is true (R) is false

Question 13.
Assertion (A): Dermatomycosis is a cutaneous infection.
Reason (R): Fungus belongs to the order Trichophyton
(a) Both (A) and (R) are true. (R) explains (A)
(b) (A) is true (R) is false
(c) Both (A) and (R) are false.
(d) (A) is false (R) is true
Answer:
(a) Both (A) and (R) are true. (R) explains (A)

Question 14.
Assertion (A): Spleen is a primary lymphoid organ
Reason (R): Primary lymphoid organs trap antigen and destroy them.
(a) Both (A) and (R) are true. (R) explains (A)
(b) (A) is true (R) is false
(c) Both (A) and (R) are false.
(d) (A) is false (R) is true
Answer:
(c) Both (A) and (R) are false.

Question 15.
Assertion (A): Paratope is the antigen-binding site.
Reason (R): It is a part of antibody
(a) Both (A) and (R) are true. (R) explains (A)
(b) (A) is true (R) is false
(c) Both (A) and (R) are false.
(d) (A) is false (R) is true
Answer:
(b) (A) is true (R) is false

Question 16.
Assertion (A): HIV is a DNA virus.
Reason (R): HIV belongs to genus Lentivirus
(a) Both (A) and (R) are true. (R) explains (A)
(b) (A) is true (R) is false
(c) Both (A) and (R) are false.
(d) (A) is false (R) is true
Answer:
(d) (A) is false (R) is true

Question 17.
Secretion of HCL in stomach is an example for __________
(a) Anatomical barriers
(b) Phagocytic barriers
(c) Physiological barriers
(d) Inflammatory barriers
Answer:
(c) Physiological barriers

Question 18.
Identify the incorrect statement.
(a) Antibody Mediated Immunity was elicited by T cells.
(b) It is a character of vertebrates only
(c) Immunoglobulins act against pathogens and kill them.
(d) It is also called humoral immunity
Answer:
(a) Antibody-Mediated Immunity was elicited by T cells.

Question 19.
Production process of blood cells in bone marrow is called __________
Answer:
hematopoiesis

Question 20.
Which of the following is not a feature of passive immunity?
(a) It is transient and less effective
(b) Immunological memory is present
(c) Immunity develops immunity
(d) Antibodies are obtained from outside
Answer:
(b) Immunological memory is present

Question 21.
__________ is a primary lymphoid organ of birds.
Answer:
Bursa of Fabricius

Question 22.
Match the following.
(a) Peyer’s patches (i) trachea
(b) BALT (ii) intestine
(c) Adenoid (iii) heart
(d) Thymus (iv) roof of the mouth
Answer:
a – ii b – i c – iv d – iii

Question 23.
Which is not a granulocyte?
(a) Lymphocytes
(b) Neutrophils
(c) Basophils
(d) Eosinophils
Answer:
(a) Lymphocytes

Question 24.
The L and H chains of immunoglobulin are joined by
(a) Hydrogen bonds
(b) disulphide bonds
(c) phosphodiester bonds
(d) ionic bond
Answer:
(b) disulphide bonds

Question 25.
__________ type of Immunoglobulin is involved in allergic reactions.
Answer:
IgE

Question 26.
Identify the wrong statement.
(a) Vaccine provide passively acquired immunity
(b) It is made from attenuated or killed microbes.
(c) Vaccines teach our body how to defend from microbes.
(d) MMR is a first generation vaccine.
Answer:
(a) Vaccine provide passively acquired immunity

Question 27
__________ developed first vaccine for smallpox.
Answer:
Edward Jenner

Question 28.
The enzyme attached to RNA of HIV is __________
(a) RNA polymerase
(b) reverse transcriptase
(c) primase
(d) endonuclease
Answer:
(b) reverse transcriptase

Question 29.
Infection of Ascariasis occur due to __________
(a) Sand fly
(b) contaminated food
(c) mosquito bite
(d) stagnant water
Answer:
(b) contaminated food

Question 30.
Which of the following statement(s) is true regarding cancer cells?
(a) Neoplasm or tumor cells show uncontrolled growth
(b) They are metastatic
(c) They lack contact inhibition
(d) They may be benign or malignant.
(a) (a) only
(b) (b) and (c)
(c) (d) only
(d) All the above
Answer:
(d) All the above

Question 31.
Study dealing with body’s defence mechanism against disease is called __________
(a) Pathology
(b) Immunology
(c) Microbiology
(d) Dermatology
Answer:
(b) Immunology

Question 32.
AIDS is characterized by sharp reduction in number of __________
(a) helper T cells
(b) killer T cells
(c) superior T cells
(d) B-cells
Answer:
(a) helper T cells

Question 33.
Plague and malaria are caused by __________ and __________ respectively.
(a) bacteria and virus
(b) fungi and protozoa
(c) bacteria and protozoan
(d) fungi and bacteria
Answer:
(c) bacteria and protozoan

Question 34.
A pair of fungal disease __________
(a) Amoebiasis, Kala-azar
(b) Candidiasis, Athlete’s foot
(c) Ascariasis, Filariasis
(d) Poliomyelitis, Amoebiasis
Answer:
(b) Candidiasis, Athlete’s foot

Question 35.
Plant source of Heroin is __________
(a) Poppy plants
(b) Cannabis plants
(c) Datura species
(d) Atropa species
Answer:
(a) Poppy plants

Question 36.
The test that confirms HIV positive is __________
(a) Western blot
(b) Northern blot
(c) Southern blot
(d) all the above
Answer:
(a) Western blot

Question 37.
Bacillary dysentery is caused due to __________
(a) Salmonella
(b) Shigella
(c) Clostridium
(d) Yersinia
Answer:
(b) Shigellosis

Question 38.
Cocaine is a __________ potent.
(a) Sedative
(b) Hallucinogen
(c) pain reliever
(d) neurotransmitter
Answer:
(b) Hallucinogen

Question 39.
Alkaloid found in tobacco is __________
(a) Atropine
(b) cocaine
(c) heroin
(d) nicotine
Answer:
(d) nicotine

Question 40.
__________ is a chronic memory disorder due to alcohol misuse.
(a) Cushing’s syndrome
(b) Turners’ syndrome
(c) Klinefelters’ syndrome
(d) Korsakoff syndrome
Answer:
(d) Korsakoff syndrome

2 – Mark Questions

Question 1.
What steps should be taken to maintain good health?
Answer:
Personal hygiene, regular exercise and balanced diet are very important to maintain good health.

Question 2.
Define disease.
Answer:
Disease can be defined as a disorder or malfunction of the mind or body. It involves morphological, physiological and psychological disturbances which may be due to environmental factors or pathogens or genetic anomalies or life style changes.

Question 3.
According to the WHO, what is health?
Answer:
The World Health Organization [WHO] defines health as ‘a state of complete physical, mental and social wellbeing and not merely absence of diseases’.

Question 4.
Differentiate between infectious and non-infections disease.
Answer:

1. Infectious disease: Disease which are transmitted form one person to another are called infectious disease, e.g. Common cold
2. Non-infectious disease: Disease which do not transmitted form one person to another are called non-infectious disease, e.g. Anaemia.

Question 5.
Name any two fungal disease and helminthic disease.
Answer:

1. Fungal disease : Candidiasis, Athlete’s foot
2. Helminthic disease : Ascariasis, Filariasis

Question 6.
Mention the causative organism of the following.

1. Tetanus
2. Bubonic plague
3. Pneumonia
4. Cholera

Answer:

1. Tetanus : Clostridium tetani
2. Bubonic plague : Yersinia pestis
3. Pneumonia : Streptococcus pneumoniae
4. Cholera : Vibrio cholerae

Question 7.
Classify viral disease based on the organ of infection.
Answer:

1. Pneumotropic diseases
2. Dermotropic diseases
3. Viscerotropic diseases
4. Neurotropic diseases

Question 8.
Write the symptoms of viral hepatitis.
Answer:

1. Liver damage
2. jaundice
3. nausea
4. yellowish eyes
5. fever and pain in the abdomen.

Question 9.
Name the different species of malarial parasites and also mention which is the fatal one?
Answer:

1. Plasmodium vivax
2. Plasmodium ovale
3. Plasmodium malariae
4. Plasmodium falciparum .
5. Plasmodium falciparum causes fatal malaria.

Question 10.
Name the causative agent and confirmatory test for Typhoid.
Answer:
Typhoid is caused by Salmonella typhi. Widal test can be done to confirm typhoid.

Question 11.
Mention the three phases in the life of plasmodium parasite with their respective host.
Answer:

1. Schizogony occurs in man.
2. Gamogony occurs in man.
3. Sporogony occurs in gut of mosquito.

Question 12.
What causes shivering in malarial patient?
Answer:
After infection of RBC with sporozoite, when the RBC ruptures a toxic substance haemozoin is released which causes shivering chills and high fever followed by sweating.

Question 13.
Malaria Eradication programme launched by WHO is a failure. Why?
Answer:
In the 1950’s the World Health Organisation (WHO) introduced the Malaria eradication programme. This programme was not successful due to the resistance of Plasmodium to the drugs used to treat it and resistance of mosquito’s to DDT and other insecticides.

Question 14.
Filarial worm and Plasmodium both are digenic parasites. Man is a common host for both parasites. Name the other host.
Answer:
The other host of filarial worm is female Culex mosquito The other host of plasmodium is female Anopheles mosquito

Question 15.
Name the causative organism of filariasis and mention the site of infection of parasite.
Answer:
Causative organisms of filariasis is Wuchereria bancrofti (filarial worm). The site of infection is lymph vessels and lymph nodes.

Question 16.
What do you mean by the term personal hygiene?
Answer:
Personal hygiene refers to maintaining one’s body clean by bathing, washing hands, trimming fingernails, wearing clean clothes and also includes attention to keeping surfaces in the home and workplace, including toilets, bathroom facilities, clean and pathogen-free.

Question 17.
Define Immunity and Susceptibility.
Answer:
The overall ability of body to fight against the disease causing pathogen is called immunity. It is also called disease resistance and the lack of immunity is known as susceptibility.

Question 18.
How skin and mucus membrane act as barriers for infections?
Answer:
Skin prevents the entry of microbes. Its acidic environment (pH 3-5) retards the growth of microbes.

Question 19.
Mucus membrane entraps foreign microorganisms and competes with microbes for attachment. What is diapedesis?
Answer:
Tissue damage and infection induce leakage of vascular fluid, containing chemotactic signals like serotonin, histamine and prostaglandins. They influx the phagocytic cells into the affected area. This phenomenon is called diapedesis.

Question 20.
Write any two differences between CMI and AMI.
Answer:
Cell Mediated Immunity (CMI):

1. In CMI, pathogens are destroyed by cells without producing antibodies.
2. It is carried out by T cells, Macrophages, NK cells

Antibody Mediated Immunity (AMI):

1. In AMI, pathogens are destroyed by antibodies.
2. It is carried out by B cells, T helper cells, APC cells.

Question 21.
Define haematopoiesis.
Answer:
The process of production of blood cells in the bone marrow is called haematopoiesis.

Question 22.
Which is the primary lymphoid organs of birds? Mention its location and role.
Answer:
Bursa of Fabricius is a primary lymphoid organ of birds. It is attached to the dorsal side of the cloaca. B lymphocytes mature in the bursa and bring about humoral immunity.

Question 23.
What are the primary lymphoid organs of mammals?
Answer:
Bone marrow and thymus gland.

Question 24.
What are Peyer’s patches?
Answer:
Peyer’s patches are oval-shaped areas of thickened tissue that are embedded in the mucus- secreting lining of the small intestine of humans and other vertebrate animals. Peyer’s patches contain a variety of immune cells, including macrophages, dendritic cells, T cells, and B cells.

Question 25.
Point out any four peripheral lymphoid organs.
Answer:
Lymph nodes, spleen, tonsils, MALT.

Question 26.
Write a brief note on GALT.
Answer:
Gut-associated lymphoid tissue (GALT) is a component of the mucosa associated lymphoid tissue (MALT) which works in the immune system to protect the body from invasion in the gut.

Question 27.
Why secondary immune response is more effective than primary immune response?
Answer:
Due to the establishment of immunological memory of the first encounter, the secondary immune response highly intense and effective.

Question 28.
Name the Agranulocytes involved in immune response.
Answer:

1. Lymphocyte
2. Monocytes

Question 29.
Why dendritic cells are called so?
Answer:
Dendritic cells are called so because its covered with long, thin membrane extensions that resemble dendrites of nerve cells. These cells present the antigen to T-helper cells.

Question 30.
How many dendritic cells are identified? Name them.
Answer:
Four types of dendritic cells are known. They are langerhans, interstitial cells, myeloid and lymphoid cells.

Question 31.
What are Haptens?
Answer:
Haptens are substance that are non-immunogenic but can react with the products of a specific immune response.

Question 32.
Distinguish between Epitope and Paratope.
Answer:

1. Epitope: Epitope is an antigenic determinant and is ‘ the active part of an antigen.
2. Paratope: A paratope is the antigen – binding site and is a part of an antibody which recognizes and binds to an antigen.

Question 33.
Draw a simplified diagram of immunoglobulin.
Answer:

Question 34.
On which basis, the antibodies are classified? Name them.
Answer:
The antibodies are classified into five major categories, based on their physiological and biochemical properties. They are IgG (gamma), IgM(mu), IgA (alpha), IgD(delta) and IgE (epsilon).

Question 35.
Name any four functions of antibodies.
Answer:
The functions of immunoglobulin are agglutination, precipitation, opsonisation, neutralization.

Question 36.
Which type of bonds are developed between an antigen and antibody? Name them.
Answer:
The bonds that hold the antigen to the antibody combining site are all non-covalent in nature. These include hydrogen bonds, electrostatic bonds, Van der Waals forces and hydrophobic bonds.

Question 37.
What is antibody affinity?
Answer:
Antibody affinity is the strength of the reaction between a single antigenic determinant and a single combining site on the antibody.

Question 38
What do you mean by third generation vaccine?
Answer:
Third generation vaccine contains the purest and the highest potency vaccines which are synthetic in generation. The latest revolution in vaccine is DNA vaccine or recombinant vaccine.

Question 39
Define vaccination.
Answer:
Vaccination is the process of administrating a vaccine into the body or the act of introducing a vaccine into the body to produce immunity to a specific disease.

Question 40.
Define allergy and allergen.
Answer:
The exaggerated response of the immune system to certain antigens present in the environment is called allergy (allo-altered, erg-reaction). The substances to which such an immune response is produced are called allergens.

Question 41.
What is Anaphylaxis?
Answer:
Anaphylaxis is the classical immediate hypersensitivity reaction. It is a sudden, systematic, severe and immediate hypersensitivity reaction occurring as a result of rapid generalized mast-cell degranulation.

Question 42.
Expand

1. MALT
2. NACO

Answer:

1. MALT – Mucosal-Associated Lymphoid Tissue
2. NACO – National AIDS Control Organisation

Question 43.
How will you define Autoimmunity?
Answer:
Autoimmunity is due to an abnormal immune response in which the immune system fails to properly distinguish between self and non-self and attacks its own body.

Question 44.
What do you mean by drug abuse?
Answer:
The intake of certain drugs for a purpose other than their normal clinical use in an amount and frequency that impair one’s physical, physiological and psychological functions is called drug abuse.

Question 45.
Name any 4 natural cannabinoids.
Answer:
Marijuana, Ganja, Hashish and Charas.

Question 46.
Mention any two drugs to treat insomnia patient.
Answer:

1. methamphetamine
2. Lysergic acid diethylamide (LSD)

Question 47.
Name the antibody responsible for allergic reaction. Also mention two chemicals released during allergic response.
Answer:
IgE (epsilon) antibody is responsible for allergic reaction. Histamine and serotonin are the chemicals released during allergic reaction.

Question 48.
Name an opioid drug and its source plant. How it is useful in medical field?
Answer:

1. Morphine is an opioid drug which is extracted from flowers of the poppy plant.
2. It is used as a strong pain killer during surgery.

Question 49.
What is withdrawal symptom? Name any two symptoms.
Answer:
If the intake of the drug or alcohol is abruptly stopped, he or she would develop withdrawal symptoms. In a sense, the body becomes confused and protests against the absence of the drug. The withdrawal symptoms are nervousness and insomnia.

Question 50.
Name the plant source of Cocaine and Heroin.
Answer:

1. Cocaine is obtained from Erythroxylum coca.
2. Heroin is obtained from poppy plant.

Question 51.
What is Liver cirrhosis?
Answer:
Alcohol interferes with the ability of the liver to break down fat. Over time fat accumulation and high levels of alcohol destroy the liver cells and a scar tissue grows in the place of dead cells. This scarring of the liver is called “Liver cirrhosis”.

Question 52.
Define Korsakoff syndrome.
Answer:
Korsakoff syndrome, a chronic memory disorder is most commonly caused by alcohol misuse.

Question 53.
What are the benefits of exercising our body?
Answer:
Participating in an exercise programme can:

1. Increase self-esteem
2. Boost self-confidence
3. Create a sense of empowerment
4. Enhance social connections and relationships

3 – Mark Questions

Question 54.
Write the name of causative agent, infection site, mode of transmission and any two symptoms of Chikungunya.
Answer:

1. Causative agent – Alpha virus
2. Infection site – Nervous system
3. Mode of transmission – Aedes aegypti (Mosquito)
4. Symptoms – Fever, headache, joint pain and swelling.

Question 55.
Draw and label the parts of Entamoeba histolytica.
Answer:

Question 56.
Give a brief account of Kala-azar.
Answer:
Kala – azar or visceral leishmaniasis is caused by Leishmania donovani, which is transmitted by the vector Phlebotomus (sand fly). Infection may occur in the endothelial cells, bone marrow, liver, lymph glands and blood vessels of the spleen. Symptoms of Kala azar are weight loss, anaemia, fever, enlargement of spleen and liver.

Question 57.
Comment on Malaria vaccine.
Answer:
Malaria vaccine is used to prevent malaria. The only approved vaccine as of 2015 is RTS,S(Mosquirix). It requires four injections and has relatively low efficacy (26-50%). Due to this low efficacy, WHO does not recommend the use of RTS,S vaccine in babies between 6 lr and 12 weeks of age.

Question 58.
What is innate immunity?
Answer:
Innate immunity is the natural phenomenon of resistance to infection which an individual possesses right from the birth. The innate defense mechanisms are non-specific in the sense that they are effective against a wide range of potentially infectious agents. It is otherwise known as non-specific immunity or natural immunity

Question 59.
Explain

1. Cell Mediated Immunity
2. Antibody Mediated Immunity

Answer:

1. Cell-mediated immunity: When pathogens are destroyed by cells without producing antibodies, then it is known as cell mediated immune response or cell mediated immunity. This is brought about by T cells, macrophages and natural killer cells.
2. Antibody mediated immunity or humoral immunity: When pathogens are destroyed by the production of antibodies, then it is known as antibody mediated or humoral immunity. This is brought about by B cells with the aid of antigen presenting cells and T helper cells. Antibody production is the characteristic feature of vertebrates only.

Question 60.
Secondary response is a booster response – Explain.
Answer:
The secondary immune response occurs when a person is exposed to the same antigen again. During this time, immunological memory has been established and the immune system can start producing antibodies immediately. Within hours after recognition of the antigen, a new army of plasma cells are generated. Within 2 to 3 days, the antibody concentration in the blood rises steeply to reach much higher level than primary response. This is also called as “booster response”.

Question 61.
What are lymphoid organs? Mention its types.
Answer:
The organs involved in the origin, maturation and proliferation of lymphocytes are called lymphoid organs. Based on their functions, they are classified into primary or central lymphoid organs and secondary or peripheral lymphoid organs.

Question 62.
Classify antigens based on origin.
Answer:
On the basis of origin, antigens are classified into exogenous antigens and endogenous antigens. The antigens which enter the host from the outside in the form of microorganisms, pollens, drugs, or pollutants are called exogenous antigens. The antigens which are formed within the individual are endogenous antigens. The best examples are blood group antigens.

Question 63.
Point out the factors that determine the binding force between antigen – antibody reactions.
Answer:
The binding force between antigen and antibody is due to three factors. They are closeness between antigen and antibody, noncovalent bonds or intermolecular forces and affinity of antibody.

Question 64.
Why it is important to study antigen-antibody interaction?
Answer:
The chief application of antigen-antibody reactions is to determine blood groups for transfusion, to study serological ascertainment of exposure to infectious agents, to develop immunoassays for the quantification of various substances, to detect the presence or absence, of protein in serum and to determine the characteristics of certain immunodeficiency diseases.

Question 65.
Explain the opsonization property of antibodies.
Answer:
Opsonisation or enhanced attachment is the process by which a pathogen is marked of ingestion and destruction by a phagocyte. Opsonization involves the binding of an opsonin i.e antibody, to a receptor on the pathogen’s cell membrane. After opsonin binds to the membrane, phagocytes are attracted to the pathogen. So, opsonization is a process in which pathogens are coated with a substance called an opsonin, marking the pathogen out for destruction by the immune system. This results in much more efficient phagocytosis.

Question 66.
Give an example for

1. First generation vaccine
2. Second generation vaccine
3. Third generation vaccine

Answer:

1. First-generation vaccine – MMR vaccine
2. Second generation vaccine – Hepatitis-B vaccine
3. Third generation vaccine – DNA Vaccine

Question 67.
Name the diseases for which vaccines were developed by Louis Pasteur.
Answer:
Cholera, Anthrax and Rabies

Question 68.
How AIDS patient fail to develop immunity?
Answer:
AIDS is caused by Human Immuno Deficiency Virus (HIV). It selectively infects helper T cells. The infected helper T cells will not stimulate antibody production by B-cells resulting in loss of natural defence against viral infection.

Question 69.
Suggest few methods to prevent AIDS.
Answer:
Prevention of AIDS is the best option. Advocating safe sex and promoting regular check-up, safe blood for transfusion, use of disposable needles, use of condoms during sexual contact, prevention of drug abuse, AIDS awareness programme by NACO (National AIDS Control Organisation), NGOs (Non-Governmental Organisations) and WHO are to prevent the spreading of AIDS.

Question 70.
State immunological surveillance theory.
Answer:
The concept of immunological surveillance postulates that the primary function of the immune system is to “seek and destroy” malignant cells that arise by somatic mutation. The efficiency of the surveillance mechanism reduces either as a result of ageing or due to congenital or acquired immunodeficiencies, leads to increased incidence of cancer. Thus, if immunological surveillance is effective, cancer should not occur. The development of tumour represents a lapse in surveillance.

Question 71.
What is contact inhibition? How it is related to tumours growth?
Answer:
Normal cells show a property called contact inhibition, which inhibits uncontrolled growth. Cancer cells do not have this property. As a result, cancerous cells divide continuously giving rise to mass of tissues called tumours.

Question 72.
Differentiate between normal cells and cancer cells.
Answer:
Normal Cells:

1. Small uniformly shaped nuclei Relatively large cytoplasmic volume
2. Conformity in cell size and shape Cells arranged into discrete tissue
3. May possess differentiated cell structures Normal presentation of cell surface markers
4. Lower levels of dividing cells Cell tissues clearly demarcated

Cancer Cells:

1. Large, variable shaped nuclei Relatively small cytoplasmic volume
2. Variation in cell size and shape Disorganised arrangement of cells
3. Loss of normal specialised features Elevated expression of certain cell markers
4. Large number of dividing cells Poorly defined tumor boundaries

Question 73.
Write a note on Heroin.
Answer:
Heroin (smack) is chemically diacetylmorphine, which is white, odourless and bitter crystalline compound. It is obtained by acetylation of morphine, which is extracted from flowers of the poppy plant.

Question 74.
“Smoking and Tobacco chewing is injurious to health” – Comment on the statement.
Answer:
Tohacco is smoked, chewed and used as snuff. It increases the carbon monoxide content of blood and reduces the concentration of haem bound oxygen, thus causing oxygen deficiency in the body. Tobacco contains nicotine, carbon monoxide and tars, which cause problems in the heart, lung and nervous system. Adrenal glands are stimulated by nicotine to release adrenaline and noradrenaline which increases blood pressure and heartbeat.

Question 75.
Point out the symptoms of mental depression.
Answer:
Signs and symptoms of mental depression:

1. Loss of self-confidence and self-esteem
2. Anxiety
3. Not being able to enjoy things that are usually pleasurable or interesting.

5-Mark Questions 

Question 76.
Name any five viral diseases, their causative agents, infection site, mode of transmission and their symptoms.
Answer:

Question 77.
Describe the life cycle of the plasmodium parasite.
Answer:
Plasmodium vivax is a digenic parasite, involving two hosts, man as the secondary host and female Anopheles mosquito as the primary host. The life cycle of Plasmodium involves three phases namely schizogony, gamogony and sporogony.

The parasite first enters the human bloodstream through the bite of an infected female Anopheles mosquito. As it feeds, the mosquito injects the saliva containing the sporozoites. ‘The sporozoite within the bloodstream immediately enters the hepatic cells of the liver. Further in the liver they undergo multiple asexual fission (schizogony) and produce merozoites. After being released from liver cells, the merozoites penetrate the RBC’s.

Inside the RBC, the merozoite begins to develop as unicellular trophozoites. The trophozoite grows in size and a central vacuole develops pushing them to one side of cytoplasm and becomes the signet ring stage. The trophozoite nucleus then divides asexually to produce the schizont. The large schizont shows yellowish-brown pigmented granules called Schuffners granules. The schizont divides and produces mononucleated merozoites. Eventually, the erythrocyte lyses, releasing the merozoites and haemozoin toxin into the bloodstream to infect other erythrocytes.

Lysis of red blood cells results in cycles of fever and other symptoms. This erythrocytic stage is cyclic and repeats itself approximately every 48 to 72 hours or longer depending on the species of Plasmodium involved. The sudden release of merozoites triggers an attack on the RBCs.

Occasionally, merozoites differentiate into macrogametocytes and microgametocytes. When these are ingested by a mosquitoe, they develop into male and female gametes respectively. In the mosquito’s gut, the infected erythrocytes lyse and male and female gametes fertilize to form a diploid zygote called ookinete. The ookinete migrates to the mosquito’s gut wall and develop into an oocyte.

The oocyte undergoes meiosis by a process called sporogony to form sporozoites. These sporozoites migrate to the salivary glands of the mosquito. The cycle is now completed and when the mosquito bites another human host, the sporozoites are injected and the cycle begins anew.

The pathological changes caused by malaria affects not only the erythrocytes but also the spleen and other visceral organs. The incubation period of malaria is about 12 days. The early symptoms of malaria are headache, nausea and muscular pain. The classic symptoms first develop with the synchronized release of merozoites, haemozoin toxin and erythrocyte debris into the bloodstream resulting in malarial paroxysms – shivering chills, high fever followed by sweating. Fever and chills are caused partly by malarial toxins that induce macrophages to release tumour necrosis factor (TNF-a) and interleukin.

Question 78.
Give an account of helminthic disease.
Answer:
Helminthes are mostly endoparasitic in the gut and blood of human beings and cause diseases called helminthiasis. The two most prevalent helminthic diseases are Ascariasis and Filariasis. Ascaris is a monogenic parasite and exhibits sexual dimorphism. Ascariasis is a disease caused by the intestinal endoparasite Ascaris lumbricoides commonly called the roundworms. It is transmitted through ingestion of embryonated eggs through contaminated food and water.

Children playing in contaminated soils are also prone to have a chance of transfer of eggs from hand to mouth. The symptoms of the disease are abdominal pain, vomiting, headache, anaemia, irritability and diarrhoea. A heavy infection can cause nutritional deficiency and – severe abdominal pain and causes stunted growth in children. It may also cause enteritis, hepatitis and bronchitis.

Filariasis is caused by Wuchereria bancrofti, commonly called a filarial worm. It is found in the lymph vessels and lymph nodes of man. Wuchereria bancrofti is sexually dimorphic, viviparous and digenic. The life cycle is completed in two hosts, man and the female Culex mosquitoes. The female filarial worm gives rise to juveniles called microfilariae larvae. In the lymph glands, the juveniles develop into adults. The accumulation of the worms blocks the lymphatic system resulting in inflammation of the lymph nodes. In some cases, the obstruction of lymph vessels causes elephantiasis or filariasis of the limbs, scrotum and mammary glands.

Question 79.
Tabulate the various types of innate immunity and their action mechanism.
Answer:

Question 80.
Point out the differences between active and passive immunity.
Answer:
Active Immunity:

1. Active immunity is produced actively by the host’s immune system.
2. It is produced due to contact with a pathogen or by its antigen.
3. It is durable and effective in protection.
4. Immunological memory is present.
5. Booster effect on subsequent dose is possible.
6. Immunity is effective only after a short period.

Passive Immunity:

1. Passive immunity is received passively and there is no active host participation.
2. It is produced due to antibodies obtained from the outside.
3. It is transient and less effective.
4. No memory.
5. A subsequent dose is less effective.
6. Immunity develops immediately.

Question 81.
How primary immune response differ from the secondary immune response?
Answer:
Primary Immune Response:

1. It occurs as a result of primary contact with an antigen.
2. Antibody level reaches peak in 7 to 10 days.
3. Prolonged period is required to establish immunity.
4. There is rapid decline in antibody level.
5. It appears mainly in the lymph nodes and spleen.

Secondary Immune Response:

1. It occurs as a result of second and subsequent contacts with the same antigen.
2. Antibody level reaches peak in 3 to 5 days.
3. It establishes immunity in a short time.
4. Antibody level remains high for longer period.
5. It appears mainly in the bone marrow, followed by the spleen and lymph nodes.

Question 82.
Explain the structure and role of thymus in primary lymphoid organ.
Answer:
Thymus is most active during the neonatal and pre-adolescent periods. The thymus is a flat and bilobed organ located behind the stemun, above the heart. Each lobe of the thymus contains numerous lobules, separated from each other by connective tissue called septa. Each lobule is differentiated into an outer cortex and an inner medulla. Within each lobule, the developing T cells called thymocytes are arranged into outer cortex and an inner medulla. The inner medulla contains immature thymocytes and outer cortex has matured thymocytes. One of its main secretions is the hormone thymosin. It stimulates the cell to become mature and immunocompetent. By the early teens, the thymus begins to atrophy and is replaced by adipose tissue.

Question 83.
Describe the structure of lymph node with a labelled diagram.
Answer:
Lymph node has three zones. They are the cortex, paracortex and medulla. The outermost layer of the lymph node is called cortex, which consists of B-lymphocytes, macrophages, and follicular dendritic cells. The paracortex zone is beneath the cortex, which is richly populated by lymphocytes and interdigitating dendritic cells. The innermost zone is called the medulla

which is sparsely populated by lymphocytes, but many of Afferentymiatic them are plasma cells, which actively secrete antibody molecules. As the lymph enters, it slowly percolates through the cortex, paracortex and medulla, giving sufficient chance for the phagocytic cells and dendritic cells to trap the antigen brought by the lymph.

The lymph leaving a node carries enriched antibodies secreted by the medullary plasma cells against the antigens that enter the lymph node. Sometimes visible swelling of lymph nodes occurs due to active immune response and increased concentration of lymphocytes. Thus swollen lymph nodes may signal an infection. There are several groups of lymph nodes. The most frequently enlarged lymph nodes are found in the neck, under the chin, in the armpits and in the groin.

Question 84.
Explain the types of cells involved in the immune system.
Answer:
Lymphocytes: About 20-30% of the white blood cells are lymphocytes. They have a large nucleus filling most of the cell, surrounded by a little cytoplasm. The two main types of lymphocytes are B and T lymphocytes. Both these are produced in the bone marrow. B lymphocytes (B cells) stay in the bone marrow until they are mature. Then they circulate around the body. Some remain in the blood, while others accumulate in the lymph nodes and spleen. T lymphocytes leave the bone marrow and mature in the thymus gland.

Once mature, T cells also accumulate in the same areas of the body as B cells. Lymphocytes have receptor proteins on their surface. When receptors on a B cell bind with an antigen, the B cell becomes activated and divides rapidly to produce plasma cells. The plasma cells produce antibodies. Some B cells do not produce antibodies but become memory cells.

These cells are responsible for secondary immune response. T lymphocytes do not produce antibodies. They recognize antigen-presenting cells and destroy them. The two important types of T cells are Helper T cells and Killer T cells. Helper T cells release a chemical called cytokine which activates B cells. Killer cells more around the body and destroy cells which are damaged or infected. Apart from these cells neutrophils and monocytes destroy foreign cells by phagocytosis. Monocytes when they mature into large cells, they are called macrophages which performs phagocytosis on any foreign organism.

Dendritic cells are called so because its covered with long, thin membrane extensions that resemble dendrites of nerve cells. These cells present the antigen to T-helper cells. Four types of dendritic cells are known. They are langerhans, interstitial cells, myeloid and lymphoid cells.

Question 85.
Write in detail about various types of antigen-antibody reactions.
Different types of antigen and antibody reactions:
Answer:
The reaction between soluble antigen and antibody leads to visible precipitate formation, which is Called precipitin reaction. Antibodies that bring about precipitate formation on reacting with antigens are called as precipitins. Whenever a particulate antigen interacts with its antibody, it would result in clumping or agglutination of the particulate antigen, which is called agglutination reaction. The antibody involved in bringing about agglutination reaction is called agglutinin.

Opsonisation or enhanced attachment is the process by which a pathogen is marked of ingestion and destruction by a phagocyte. Opsonisation involves the binding of an opsonin antibody, to a receptor on the pathogen’s cell membrane. After opsonin binds to the membrane, phagocytes are attracted to the pathogen. So, opsonisation is a process in which pathogens are coated with a substance called an opsonin, marking the pathogen out for destruction by the immune system. This results in a much more efficient phagocytosis.

The neutralization reactions are the reactions of antigen-antibody that involve the elimination of harmful effects of bacterial exotoxins or a virus by specific antibodies. These neutralizing substances i.e. antibodies are known as antitoxins. This specific antibody is produced by a host cell in response to a bacterial exotoxin or corresponding toxoid (inactivated toxin).

Question 86.
Describe the structure of HIV with a diagram.
Answer:
The human immunodeficiency virus belongs to the genus Lentivirus. When observed under the electron microscope, HIV is seen as a spherical virus, 100-120 nm in diameter, containing a dense .core surrounded by a lipoprotein envelope.The envelope has glycoprotein (gp) spikes termed gp 41 and gp 120. At the core, there are two large single stranded RNA. Attached to the RNA are molecules of reverse transcriptase.

It also contains enzymes like protease and ribonuclease. The core is covered by a capsid made of proteins. This is followed by another layer of matrix proteins as shown above.

Question 95.
Suggest some of the ways to prevent drug and alcohol abuse.
Answer:

1. Effectively dealing with peer pressure: The biggest reason for teens to start on drugs is due to their friends/peer groups imposing pressure on them. Hence, it is important to have a better group of friends to avoid such harmful drugs and alcohol.
2. Seeking help from parents and peers: Help from parents and peer group should be sought immediately so that they can be guided appropriately. Help may even be sought from close and trusted friends. Getting proper advice to sort out their problems would help the young to vent their feelings of anxiety and guilt.
3. Education and counselling: Education and counselling create positive attitude to deal with many problems and to accept disappointments in life.
4. Looking for danger signs: Teachers and parents need to look for sign that indicates a tendency to go in for addiction.
5. Seeking professional and medical assistance: Assistance is available in the form of highly qualified psychologists, psychiatrists and de-addiction and rehabilitation programmes to help individuals to overcome their problems.

Higher Order Thinking Skills (HOTs) Questions

Question 1.
Identify the mismatched pair and give a reason.
(a) Plague – Yersinia pestis
(b) Filariasis – Wuchereria bancrofti
(c) Dermatomycosis – Trypanosoma gambiense
(c) Common cold – Rhinovirus
Answer:
(c) Dermatomycosis – Trypanosoma gambiense is the mismatched pair. Dermatomycosis is a cutaneous infection caused by fungus.

Question 2.
In which form does the malarial parasite enter the human body through mosquito? What is the target site of the parasite immediately after entering the host body?
Answer:

1. Sporozoites.
2. After entering the bloodstream of the host it finally reaches the liver cell.

Question 3.
A boy of ten years had suffered from chicken-pox. His grandmother consoled him that he is not expected to have it for the rest of his life. Whether his grandmother is right? If so how it happens?
Answer:
The infection produces not only antibodies but also generates memory in the lymphocytes. These cells recognize the pathogen on the subsequent attacks and generate antibodies to neutralize the pathogen, so his grandmother is right and the boy will not get the disease for the rest of his life.

Students can Download Bio Botany Chapter 6 Cell: The Unit of Life Questions and Answers, Notes Pdf, Samacheer Kalvi 11th Bio Botany Book Solutions Guide Pdf helps you to revise the complete Tamilnadu State Board New Syllabus and score more marks in your examinations.

Tamilnadu Samacheer Kalvi 11th Bio Botany Solutions Chapter 6 Cell: The Unit of Life

Samacheer Kalvi 11th Bio Botany Cell: The Unit of Life Text Book Back Questions and Answers

I. Multiple Choice Questions
Choose the correct answer
Question 1.
The two subunits of ribosomes remain united at critical ion level of …………… .
(a) Magnesium
(b) Calcium
(c) Sodium
(d) Ferrous
Answer:
(a) Magnesium

Question 2.
Sequences of which of the following is used to know the phylogeny?
(a) mRNA
(b) rRNA
(c) tRNA
(d) Hn RNA
Answer:
(b) rRNA

Question 3.
Many cells function properly and divide mitotically even though they do not have …………… .
(a) Plasma membrane
(b) Cytoskeleton
(c) Mitochondria
(d) Plastids
Answer:
(d) Plastids

Question 4.
Keeping in view the fluid mosaic model for the structure of cell membrane, which one of the following statements is correct with respect to the movement of lipids and proteins from one lipid monolayer to the other…………… .
(a) Neither lipid nor proteins can flip – flop
(b) Both lipid and proteins can flip – flop
(c) While lipids can rarely flip – flop proteins cannot
(d) While proteins can flip – flop lipids cannot
Answer:
(c) While lipids can rarely flip – flop proteins cannot

Question 5.
Match the columns and identify the correct option:

Answer:
(c) iii, iv, i, ii.

Question 6.
Bring out the significance of phase contrast microscopy.
Answer:
Phase contrast microscope is used to observe living cells, tissues and the cells cultured invitro during mitosis.

Question 7.
State the protoplasm theory.
Answer:
Protoplasm theory was proposed by Max Schultze which states that the protoplasm is the living content of cell and is a complex colloidal system.

Question 8.
Distinguish between prokaryotes and eukaryotes.
Answer:
Between prokaryotes and eukaryotes:

Question 9.
Difference between plant and animal ceil.
Answer:

Plant Cell	Animal Cell
1. Usually they are larger than animal cells	1. Usually smaller than plant cells
2. Cell wall present in addition to plasma membrane and consists of middle lamellae, primary and secondary walls	2. Cell wall absent
3. Plasmodesmata present	3. Plasmodesmata absent
4. Chloroplast present	4. Chloroplast absent
5. Vacuole large and permanent	5. Vacuole small and temporary
6. Tonoplast present around vacuole	6. Tonoplast absent
7. Centrioles absent except motile cells of lower plants	7. Centrioles present
8. Nucleus present along the periphery of the cell	8. Nucleus at the centre of the cell
9. Lysosomes are rare	9. Lysosomes present
10. Synthesizes amino acids, coenzymes and vitamins required by them	10. Cannot synthesize aminoacids, coenzymes and vitamins required by them
11. Storage material is starch grains	11. Storage material is a glycogen granules

Question 10.
Draw the ultra structure of Plant Cell.
Answer:
The ultra structure of Plant Cell:

Samacheer Kalvi 11th Bio Botany Cell: The Unit of Life Additional Questions and Answers

I. Multiple Choice Questions
Choose the correct answer:
Question 1.
Scientist who named the unicellular particles as ‘animalcules’ …………… .
(a) Aristotle
(b) Robert Brown
(c) Antonie von Leeuwenhoek
(d) Robert Hooke
Answer:
(c) Antonie van Leeuwenhoek

Question 2.
Cell theory was modified by …………… .
(a) Schwann
(b) Schleiden
(c) Virchow
(d) Dutrochet
Answer:
(c) Virchow

Question 3.
Which of the following microscope produce 3D – image?
(a) Phase contrast
(b) TEM
(c) SEM
(d) Dark field
Answer:
(c) SEM

Question 4.
Which of the following electron opaque chemical is used in Electron microscope?
(a) Strontium
(b) Deuterium
(c) Palladium
(d) Uranium
Answer:
(c) Palladium

Question 5.
Medium for electron movement in TEM is …………… .
(a) Air
(b) Oil
(c) Water
(d) Vacuum
Answer:
(d) Vacuum

Question 6.
Resolving power of SEM is …………… .
(a) 5 – 10 Å
(b) 2 – 10 Å
(c) 5 – 20 nm
(d) 5 – 20 m
Answer:
(c) 5 – 20 nm

Question 7.
Which among the following is NOT an exception to cell theory?
(a) Viruses
(b) Viroids
(c) Prions
(d) Fungi
Answer:
(d) Fungi

Question 8.
Scientist who named the cytoplasm as “Sarcode” is …………… .
(a) Dujardin
(b) Corti
(c) Purkinje
(d) Hugo Van Mohl
Answer:
(a) Dujardin

Question 9.
The pH of protoplasm is around …………… .
(a) 6.6
(b) 6.7
(c) 6.8
(d) 6.9
Answer:
(c) 6.8

Question 10.
The refractive index of protoplasm is …………… .
(a) 1.4
(b) 2.4
(c) 3.4
(d) 0.4
Answer:
(a) 1.4

Question 11.
Histone proteins are seen in the DNA of …………… .
(a) Pseudokaryotes
(b) Prokaryotes
(c) Mesokaryotes
(d) Eukaryotes
Answer:
(d) Eukaryotes

Question 12.
Which of the following organelle is believed to be an endosymbiont?
(a) Ribosomes
(b) Mitochondrion
(c) Golgi bodies
(d) Nucleus
Answer:
(b) Mitochondrion

Question 13.
is the living content of the cell …………… .
(a) Cytoplasm
(b) Protoplasm
(c) Nucleoplasm
(d) Nucleus
Answer:
(b) Protoplasm

Question 14.
Fungal cell wall is made of …………… .
(a) Cutin
(b) Chitin
(c) Hemicellulose
(d) Pectin
Answer:
(b) Chitin

Question 15.
…………… acts as a channel between the protoplasm of adjacent cells.
(a) Middle lamellae
(b) Pits
(c) Plasmodesmata
(d) Primary cell wall
Answer:
(c) Plasmodesmata

Question 16.
Fluid mosaic model was proposed by …………… .
(a) Schleiden and Schwann
(b) Singer and Nicolson
(c) Binning and Roher
(d) G. Palade
Answer:
(b) Singer and Nicolson

Question 17.
Which is the largest of the internal membranes?
(a) Golgi bodies
(b) Endoplasmic reticulum
(c) Tonoplast
(d) Nuclear membrane
Answer:
(b) Endoplasmic reticulum

Question 18.
In plant cells, golgi bodies are found as small vesicles called …………… .
(a) Polysomes
(b) Cytosomes
(c) Cytosol
(d) Dictyosomes
Answer:
(d) Dictyosomes

Question 19.
organelle plays a major role in post translation process of protein …………… .
(a) Golgi bodies
(b) Nucleolus
(c) Ribosomes
(d) ER
Answer:
(a) Golgi bodies

Question 20.
Zymogen granules are synthesized in …………… .
(a) Lysosomes
(b) Golgi bodies
(c) Mitochondria
(d) Chloroplast
Answer:
(b) Golgi bodies

Question 21.
Altmann named mitochondrion as …………… .
(a) Apoplast
(b) Elaioplast
(c) Symplast
(d) Bioplast
Answer:
(d) Bioplast

Question 22.
DNA of mitochondrion is …………… .
(a) Helical
(b) Dumb – bell
(c) Circular
(d) Spiral
Answer:
(c) Circular

Question 23.
Mitochondria are inherited from parent …………… .
(a) Male
(b) Female
(c) Both
(d) None
Answer:
(b) Female

Question 24.
F₁ particles are also called as …………… .
(a) Polysomes
(b) Glyoxysomes
(c) Peroxisomes
(d) Oxysomes
Answer:
(d) Oxysomes

Question 25.
Elaioplasts store …………… .
(a) Starch
(b) Lipid
(c) Protein
(d) Chlorophyll
Answer:
(b) Lipid

Question 26.
The photosynthetic units are called as …………… .
(a) Oxysomes
(b) Quantosomes
(c) Thylakoids
(d) Chloroplasts
Answer:
(b) Quantosomes

Question 27.
Which organelle is not membrane bound?
(a) Mitochondrion
(b) Golgi bodies
(c) Chloroplast
(d) Ribosomes
Answer:
(d) Ribosomes

Question 28.
Ribosomes of mitochondrion are …………… .
(a) 16 S
(b) 80 S
(c) 70 S
(d) 50 S
Answer:
(c) 70 S

Question 29.
…………… mineral is required for structural cohesion of ribosomes.
(a) Ca²⁺
(b) H⁺
(c) Mg²⁺
(d) Cl^–
Answer:
(c) Mg²⁺

Question 30.
Lysosomes originate from …………… .
(a) Mitochondrion
(b) Nucleus
(c) ER
(d) Golgi bodies
Answer:
(d) Golgi bodies

Question 31.
In mammals, peroxisomes are seen in …………… cells.
(a) Brain
(b) Lung
(c) Liver
(d) Heart
Answer:
(c) Liver

Question 32.
Which organelle has a single unit membrane?
(a) Ribosomes
(b) Glyoxysomes
(c) Polysomes
(d) Nucleus
Answer:
(b) Glyoxysomes

Question 33.
The single unit membrane of vacuoles is called as …………… .
(a) Tonoplast
(b) Symplast
(c) Apoplast
(d) Amyloplast
Answer:
(a) Tonoplast

Question 34.
Vacuoles of Apple cells store …………… .
(a) Sucrose
(b) Malic acid
(c) Citrate
(d) Flavanoid
Answer:
(b) Malic acid

Question 35.
Ribosomal biogenesis occur at …………… .
(a) Mitochondrion
(b) Polysomes
(c) Nucleolus
(d) Chromosomes
Answer:
(c) Nucleolus

Question 36.
The term chromosome was introduced by …………… .
(a) Bridges
(b) Strasburger
(c) Waldeyer
(d) Poster
Answer:
(c) Waldeyer

Question 37.
Stability to chromosome is offered by …………… .
(a) Satellite
(b) Telomere
(c) Kinetochore
(d) Nucleolus
Answer:
(b) Telomere

Question 38.
Life span of the cells is determined by …………… .
(a) Kinetochore
(b) Satellite
(c) Chromatin
(d) Telomere
Answer:
(d) Telomere

Question 39.
The metacentric chromosomes are …………… shaped.
(a) L
(b) V
(c) J
(d) I
Answer:
(b) V

Question 40.
Polytene chromosomes are observed in …………… of Drosophila.
(a) Endocrine gland
(b) Gall bladder
(c) Salivary gland
(d) Exocrine gland
Answer:
(c) Salivary gland

Question 41.
Lampbrush chromosomes occur at …………… stage of meiotic Prophase I.
(a) Leptotene
(b) Diplotene
(c) Zygotene
(d) Pachytene
Answer:
(b) Diplotene

Question 42.
Number of basal rings in gram positive bacteria …………… .
(a) 2
(b) 4
(c) 6
(d) 8
Answer:
(a) 2

Question 43.
Microtubules are made of …………… .
(a) Dyenin
(b) Tubin
(c) Tubulin
(d) Nexin
Answer:
(c) Tubulin

Question 44.
Cytoplasm is stained …………… by eosin.
(a) Pink
(b) Blue
(c) Greenish blue
(d) Green
Answer:
(a) Pink

Question 45.
Key difference between plant cell & animal cell is …………… .
(a) Ribosomes
(b) Vacuoles
(c) Cell wall
(d) Centrioles
Answer:
(c) Cell wall

II. Very Short Answer Type Questions (2 Marks)

Question 1.
Name the scientist who proposed the cell theory.
Answer:
Matthias Schleiden and Theodor Schwann.

Question 2.
Define resolving power of a microscope.
Answer:
Resolving power or resolution refers to the ability of the lenses to show the details of object lying between two points. It is the finest detail available from an object. It can be calculated using the following formula.
⇒ Resolution = \(\frac {0.61λ}{NA}\),
where λ, = wavelength of the light and
NA is the numerical aperture.

Question 3.
Define magnification. How will you calculate it?
Answer:
The optical increase in the size of an image is called magnification. It is calculated by the following formula

Question 4.
List out the types of objective lenses used in Bright field microscope.
Answer:
The types of objective lenses used in Bright field microscope:

1. 5x
2. 10x
3. 45x
4. 100x

Question 5.
In Bright field microscope, where does the primary & secondary magnification occurs?
Answer:
Primary magnification is obtained through, objective lens and secondary magnification is obtained through eye piece lens.

Question 6.
List out the components of Electron microscope.
Answer:
The components of the microscope are as follows:

1. Electron Generating System
2. Electron Condensor
3. Specimen Objective
4. Tube Lens
5. Projector

Question 7.
Name the organisms that are exceptions to cell theory.
Answer:
Viruses, Virions and Prions.

Question 8.
Name the types of cells based on nuclear characteristics.
Answer:
The types of cells based on nuclear characteristics:

1. Prokaryotes
2. Mesokaryotes and
3. Eukaryotes.

Question 9.
Define nucleoid.
Answer:
Nucleoid refers to the primitive nucleus which is not bound by nuclear membrane and the DNA is without histone protein.

Question 10.
Name the organelles which are believed to be endosymbiont in Eukaryote cell.
Answer:
Chloroplast and Mitochondrion.

Question 11.
Write a note on endosymbiont theory.
Answer:
Two eukaryotic organelles believed to be the descendants of the endosymbiotic prokaryotes. The ancestors of the eukaryotic cell engulfed a bacterium and the bacteria continued to function inside the host cell.

Question 12.
Point out any four prokaryotes.
Answer:Four prokaryotes:

1. Bacteria
2. Blue Green algae
3. Mycoplasma and
4. Rickettsiae.

Question 13.
Why spirochaetae is said to be a prokaryote?
Answer:
Spirochaetae is a prokaryote since its DNA lies in nucleoid and not bound by nuclear membrane and also devoid of histone protein.

Question 14.
Name any two unique structures / organelles of a plant cell.
Answer:
Cell wall and Chloroplast.

Question 15.
What are the components of protoplasm?
Answer:
Protoplasm is composed of a mixture of small particles, such as ions, amino acids, monosaccharides, water, macro-molecules like nucleic acids, proteins, lipids and polysaccharides.

Question 16.
What is the cell wall composition of the following organism?
(a) Fungi
(b) Bacteria
(c) Algae
Answer:
(a) Fungi – Chitin and fungal cellulose.
(b) Bacteria – Peptidoglycan
(c) Algae – Cellulose, mannan and galactan.

Question 17.
Which cell wall layer of plant cell is laid during maturation? Mention its role.
Answer:
Secondary wall is laid during maturation. It plays a key role in determining the shape of a cell.

Question 18.
How pits are formed?
Answer:
In plant cell, at few regions the secondary wall layer is laid unevenly, whereas the primary wall and middle lamellae are laid continuously such regions are called pits.

Question 19.
What is the role of plasmodesmata in a plant cell?
Answer:
Plasmodesmata act as a channel between the protoplasm of adjacent cells through which many substances pass through.

Question 20.
Name the two types of Pits.
Answer:
The two types of Pits:

1. Simple pit and
2. Bordered pit.

Question 21.
Define flip – flop movement.
Answer:
The movement of membrane lipids from one side of the membrane to the other side by vertical movement is called flip – flopping or flip – flop movement.

Question 22.
Name the two types of protein seen in cell membrane.
Answer:
Two types of protein seen in cell membrane:

1. Integral proteins and
2. peripheral proteins.

Question 23.
Define cytoplasmic streaming.
Answer:
Cytoplasmic streaming refers to the movement of the cytoplasm along with the cellular materials inside the cell.

Question 24.
Name any four endomembrane structures.
Answer:
Four endomembrane structures:

1. Nuclear membrane
2. endoplasmic reticulum
3. vascular membrane
4. golgi bodies.

Question 25.
What are dictyosomes?
Answer:
In plant cells, the golgi bodies are found as small vesicles which are called as dictyosomes.

Question 26.
What are porins?
Answer:
Porins are the proteins in the outer membrane of mitochondrion which forms the channel that allows the free diffusion of molecules smaller than about 1000 daltons.

Question 27.
What are oxysomes?
Answer:
The inner membrane of mitochondrion consists of stalked particles called elementary particles or Fernandez Moran particles. F₁ particles or oxysomes.

Question 28.
How mitochondria helps in evolutionary studies?
Answer:
Mitochondrial DNA is used to track and date recent evolutionary time because it mutates 5 to 10 time faster than DNA in the nucleus.

Question 29.
Why mitochondrion is called as semi – autonomous organelle?
Answer:
Since mitochondria has it own DNA, it is called as Organelle.

Question 30.
Why mitochondria are called “Power houses of cell?
Answer:
Mitochondria are called Power house of a cell, as they produce energy rich (Adenosine Triphosphate) ATP.

Question 31.
Classify plastids based on colour.
Answer:
Chloroplast, Phaeoplast and Rhodoplast.

Question 32.
Classify plastids based on storage & mention their storage component.
Answer:

Plastids	Storage Content
1. Amyloplast	1. Starch
2. Elaioplast	2. Lipids / Oils
3. Aleuroplast or Proteoplast	3. Protein

Question 33.
What are Quantosomes?
Answer:
Quantosomes are small, rounded photosynthetic units present in thylakoids.

Question 34.
List out the functions of chloroplast.
Answer:
Photosynthesis, photo respiration.

Question 35.
What is Svedberg unit?
Answer:
Svedberg unit is a measure of a particle size dependent on the speed with which particle sediment in the ultracentrifuge.

Question 36.
Where the biogenesis of ribosomes occur?
Answer:
Biogenesis of ribosome are denova formation, auto replication and nucleolar origin.

Question 37.
What are Polysomes? State its function.
Answer:
During protein synthesis many ribosomes are attached to the single mRNA called polysomes or polyribosomes. The function of polysomes is the formation of several copies of a particular polypeptide during protein synthesis.

Question 38.
Define Autolysis.
Answer:
Autolysis is the process, where the lysosome causes self destruction of cell on insight of disease they destroy the cells.

Question 39.
List out the enzymes of lysosomes.
Answer:
Acid Hydrolases, Nuclease, Proteases, Glycosidases, Lipases, Phosphatases, Sulphatases and Phospholipidases.

Question 40.
Name any two organelles involved in photorespiration.
Answer:
Peroxisomes and Chloroplast.

Question 41.
Name few single unit membrane bound organelles.
Answer:
Peroxisomes, Glyoxysomes and Sphaerosomes.

Question 42.
What are Tonoplast?
Answer:
In plant cells vacuoles are large, bounded by a single unit membrane called Tonoplast.

Question 43.
How vacuoles helps to maintain the structure of a plant cell?
Answer:
The major function of plant vacuole is to maintain water pressure known as turgor pressure, which maintains the plant structure.

Question 44.
What are metachromatic granules?
Answer:
Inorganic inclusions in bacteria are polyphosphate granules (volutin granules) and sulphur granules. These granules are also known as metachromatic granules.

Question 45.
Which is the largest organelle in a cell? State its function.
Answer:
Nucleus. It controls all the cellular activities.

Question 46.
What is a pore complex?
Answer:
The pores are enclosed by circular structures called annuli. The pore and annuli forms the pore complex.

Question 47.
What are nucleolar organizers region?
Answer:
Secondary constrictions contains the genes for ribosomal RNA which induce the formation of nucleoli and are called nucleolar organizer regions.

Question 48.
Draw the types of chromosomes based on centromere position.
Answer:
The types of chromosomes based on centromere position:

Question 49.
What is a telomere?
Answer:
Telomere is the terminal part of chromosome. It offers stability to the chromosome. DNA of the telomere has specific sequence of nucleotides.

Question 50.
Classify chromosomes based on function.
Answer:
Autosomes and sex chromosomes.

Question 51.
Name any two giant chromosomes.
Answer:
Polytene chromosomes and lamp brush chromosomes.

Question 52.
Define proton motive force.
Answer:
The proton motive force is the force derived from the electrical potential and the hydrogen ion gradient across the cytoplasmic membrane.

Question 53.
Name the basal rings found in flagella of gram negative bacteria.
Answer:
The basal rings found in flagella of gram negative bacteria:

• L – Lipopolysacchride ring
• P – Peptidoglycan ring
• S – Super membrane ring and
• M – membrane ring.

Question 54.
(a) Define histochemistry.
(b) What is Somatic pairing?
Answer:
(a) The technique of staining the cells and tissue is called histochemical staining or histo chemistry.
(b) Maternal and paternal homologues remain associated side by side is called somatic pairing.

III. Short Answer Type Questions (3 Marks)

Question 1.
Explain the principle involved in Scanning Electron Microscope (SEM).
Answer:
In Scanning Electron Microscope (SEM) electrons are focused by means of lenses into a very fine point. The interaction of electrons with the specimen results in the release of different forms of radiation (such as auger electrons, secondary electrons, back scattered electrons) from the surface of the specimen. These radiations are then captured by an appropriate detector, amplified and then imaged on fluorescent screen.

Question 2.
Write a note on solation gelation property of protoplasm.
Answer:
The protoplasm exist either in semisolid (jelly – like) state called ‘gel’ due to suspended particles and various chemical bonds or may be liquid state called ‘sol’. The colloidal protoplasm which is in gel form can change into sol form by solation and the sol can change into gel by gelation. These gel – sol conditions of colloidal system are prime basis for mechanical behaviour of cytoplasm.

Question 3.
Explain the nuclear characters of Mesokaryotes.
Answer:
Mesokaryotes contains well organized nucleus with nuclear membrane and the DNA is organized into chromosomes but without histone protein components divides through amitosis similar with prokaryotes.

Question 4.
List out the unique characters of a Eukaryotic cell.
Answer:
Eukaryotes have true nucleus. The DNA is associated with protein bound histones forming the chromosomes. Membrane bound organelles are present.

Question 5.
Name the chemicals seen in the cell wall of plant cells.
Answer:
Cellulose, hemicellulose, pectin, lignin, cutin, suberin and silica.

Question 6.
Name the 3 distinct regions of plant cell wall.
Answer:
In plant, cell wall shows three distinct regions

1. Primary wall
2. Secondary wall and
3. Middle lamellae.

Question 7.
Explain the role of hemicellulose, pectin & glycoprotein in primary cell wall.
Answer:
Hemicellulose binds the microfibrils with matrix and glycoproteins control the orientation of microfibrils while pectin serves as filling material of the matrix.

Question 8.
In cell membrane, phospholipids undergo flip – flop movement but not the protein. Why?
Answer:
The phospholipids can have flip – flop movement because the phospholipids have smaller polar regions, whereas the proteins cannot flip – flop because the polar region is extensive.

Question 9.
Define signal transduction.
Answer:
The process by which the cells receive information from outside and respond is called signal transduction.

Question 10.
Distinguish between rough endoplasmic reticulum and smooth endoplasmic reticulum.
Answer:
Between rough endoplasmic reticulum and smooth endoplasmic reticulum:

RER	SER
1. Ribosomes are present in the outer surface of membrane	1. Ribosomes are absent on the membrane
2. It is involved in protein synthesis	2. It is involved in lipid synthesis

Question 11.
Write the major roles of Golgi bodies.
Answer:
Golgi complex plays a major role in post translational modification of proteins and glycosidation of lipids.

Question 12.
Which is the most abundant protein on Earth? Where it is encoded?
Answer:
Rubisco is the abundant protein on Earth. It is encoded by the chloroplast DNA.

Question 13.
Classify ribosomes with an example.
Answer:
Types of Ribosomes
1. 70S Ribosomes (subunit 30S and 50S): 3 RNA molecule

• 16SrRNA in 30S subunit
• 23S and 5S in 50S large subunit
  (Prokaryotic cells of Blue green algae, Bacteria, Mitochondria and Chloroplast of many Algae and higher plants)

2. 80S Ribosomes (subunits 40S and 60S): 4 RNA molecule

• 18Sr RNA in 40S small sub unit
• 28S, 5.8S and 5S in larger 60S subunit.
  (Eukaryotic cells of plants and animals).

Question 14.
Write a note on Glyoxysomes.
Answer:
Glyoxysome is a single membrane bound organelle. It is a sub cellular organelle and contains enzymes of glyoxylate pathway – oxidation of fatty acid occurs in glyoxysomes of germinating seeds.

Question 15.
What are cell inclusions? Give example.
Answer:
The cell inclusions are the non – living materials present in the cytoplasm. They are organic and inorganic compounds.  Example: Phosphate granules.

Question 16.
Draw and label the structure of Nucleus.
Answer:
The structure of Nucleus:

Question 17.
Distinguish between Euchromatin & Heterochromatin.
Answer:
The portion of Eukaryotic chromosome which is transcribed into mRNA contains active genes that are not tightly condensed during interphase is called Euchromatin. The portion of a Eukaryotic chromosome that is not transcribed into mRNA which remains condensed during interphase and stains intensely is called Heterochromatin.

Question 18.
Define Kinetochore.
Answer:
The centromere contains a complex system of protein fibres called kinetochore. Kinetochore is the region of chromosome which is attached to the spindle fibre during mitosis.

Question 19.
Write a note on SAT – chromosome.
Answer:
A satellite or SAT – chromosome are short chromosomal segment or rounded body separated from main chromosome by a relatively elongated secondary constriction. It is a morphological entity in certain chromosomes.

Question 20.
How telomeres helps in cancer studies?
Answer:
Maintenance of telomeres appears to be an important factor in determining the life span and reproductive capacity of cells so studies of telomeres and telomerase have the promise of providing new insights into conditions such as ageing and cancer.

Question 21.
Name the three types of centromere in eukaryotes.
Answer:
The three types of centromere in eukaryotes:

1. Point centromere
2. Regional centromere and
3. Holocentromere.

Question 22.
What are giant chromosomes?
Answer:
These chromosomes are larger in size and are called giant chromosomes. In certain plants they are found in the suspensors of the embryo. The polytene chromosome and lamp brush chromosome occur in animals and are also called as giant chromosomes.

Question 23.
How polyteny condition is achieved?
Answer:
Polyteny is achieved by repeated replication of chromosomal DNA several times without nuclear division and the daughter chromatids aligned side by side and do not separate (endomitosis).

Question 24.
What is Microphotography?
Answer:
Images of structures observed through microscopes can be further magnified, projected and saved by attaching a camera to the microscope by a microscope coupler or eyepiece adaptor. Picture taken using a inbuilt camera in a microscope is called microphotography or microphotograph.

Question 25.
Draw the Structure of Peroxisomes.
Answer:
The Structure of Peroxisomes:

IV. Long Answer Type Questions (5 Marks)

Question 1.
Write a detailed account on Dark field microscope.
Answer:
The dark field microscope was discovered by Z. Sigmondy (1905). Here the field will be dark but object will be glistening so the appearance will be bright. A special effect in an ordinary microscope is brought about by means of a special component called “Patch Stop Carrier”. It is fixed in metal ring of the condenser component.

Patch stop is a small glass device which has a dark patch at centre of the disc leaving a small area along the margin through which the light passes. The light passing through the margin will travel oblique like a hollow cone and strikes the object in the periphery, therefore the specimen appears glistening in a dark background.

Question 2.
Compare Transmission Electron Microscope with Scanning Electron Microscope.
Answer:
Transmission Electron Microscope with Scanning Electron Microscope:

Question 3.
List out the features of Cell Doctrine.
Answer:
The features of cell doctrine are as follows:

1. All organisms are made up of cells.
2. New cells are produced from the pre – existing cells.
3. Cell is a structural and functional unit of all living organisms.
4. A cell contains hereditary information which is passed on from cell to cell during cell division.
5. All the cells are basically the same in chemical composition and metabolic activities.
6. The structure and function of cell is controlled by DNA.
7. Sometimes the dead cells may remain functional as tracheids and vessels in plants and horny cells in animals.

Question 4.
Enumerate the properties of protoplasm.
Answer:
The properties of protoplasm:

1. Protoplasm is translucent, odourless and polyphasic fluid.
2. It is a crystal colloid solution which is a mixture of chemical substances forming crystalloid and colloidal solution.
3. Protoplasm exhibits three Brownian movement, amoeboid movement and cytoplasmic streaming or cyclosis. Viscosity of protoplasm is 2 – 20 centipoises. The Refractive index of the protoplasm is 1.4.
4. The pH of the protoplasm is around 6.8, contain 90% water (10% in dormant seeds).
5. Approximately 34 elements are present in protoplasm but only 13 elements are main or universal elements i.e. C, H, O, N, Cl, Ca, P, Na, K, S, Mg, I and Fe. Carbon, Hydrogen, Oxygen and Nitrogen form the 96% of protoplasm.
6. Protoplasm is neither a good nor a bad conductor of electricity.
7. Cohesiveness: Particles or molecules of protoplasm are adhered with each other by forces, such as Van der Waal’s bonds, that hold long chains of molecules together. This property varies with the strength of these forces.
8. Contractility: The contractility of protoplasm is important for the absorption and removal of water especially stomatal operations.
9. Surface Tension: The proteins and lipids of the protoplasm have less surface tension, hence they are found at the surface forming the membrane. On the other hand the chemical substances (NaCl) have high surface tension, so they occur in deeper parts of the cell protoplasm.

Question 5.
List out the functions of the Cell Wall.
Answer:
The cell wall plays a vital role in holding several important functions given below.

1. Offers definite shape and rigidity to the cell.
2. Serves as barrier for several molecules to enter the cells.
3. Provides protection to the internal protoplasm against mechanical injury.
4. Prevents the bursting of cells by maintaining the osmotic pressure.
5. Plays a major role by acting as a mechanism of defense for the cells.

Question 6.
Explain in detail about Fluid mosaic model.
Answer:
Jonathan Singer and Garth Nicolson (1972) proposed fluid model: It is made up of lipids and proteins together with a little amount of carbohydrate. The lipid membrane is made up of phospholipid. The phospholipid molecule has a hydrophobic tail and hydrophilic head. The hydrophobic tail repels water and water loving polar molecule are called hydrophilic molecule. They have polar phosphate group responsible for attracting water. Water hating non – polar molecule are called as hydrophobic molecule. They have fatty acid which is non – polar which cannot attract water.

Hydrophilic head attracts water. The proteins of the membrane are globular proteins which are found intermingled between the lipid bilayer most of which are projecting beyond the lipid bilayer. These proteins are called as integral proteins. Few are superficially attached on either surface of the lipid bilayer which are called as peripheral proteins. The proteins are involved in transport of molecules across the membranes and also act as enzymes, receptors or antigens.

Question 7.
Describe Endocytosis and Exocytosis.
Answer:
Cell surface membrane are able to transport individual molecules and ions. There are processes in which a cell can transport a large quantity of solids and liquids into cell endocytosis or out of cell exocytosis.

1. Endocytosis: During endocytosis the cell wraps the cell surface membrane around the material and brings it into cytoplasm inside a vesicle. There are two types of endocytosis:

• Phagocytosis – Particle is engulfed by membrane, which folds around it and forms a vesicle. The enzymes digest the material and products are absorbed by cytoplasm.
• Pinocytosis – Fluid droplets are engulfed by membrane, which forms vesicles around them.

2. Exocytosis: Vesicles fuse with plasma membrane and eject contents. This passage of material out the cell is known as exocytosis. This material may be a secretion in the case of digestive enzymes, hormones or mucus.

Question 8.
List out the functions of Golgi bodies.
Answer:
Functions of Golgi bodies:

1. Glycoproteins and glycolipids are produced.
2. Transporting and storing lipids.
3. Formation of lysosomes.
4. Production of digestive enzymes.
5. Cell plate and cell wall formation
6. Secretion of carbohydrates for the formation of plant cell walls and insect cuticles.
7. Zymogen granules (proenzyme / pre – cursor of all enzyme) are synthesized.

Question 9.
Draw & describe the structure of mitochondrion.
Answer:
Mitochondria are ovoid, rounded, rod shape and pleomorphic structures. Mitochondrion consists of double membrane, the outer and inner membrane. The outer membrane is smooth, highly permeable to small molecules and it contains proteins called Porins, which form channels that allows free diffusion of molecules smaller than about 1000 daltons and the inner membrane divides the mitochondrion into two compartments, outer chamber between two membranes and the inner chamber filled with matrix.

The inner membrane is convoluted (infoldings), called crista (plural: cristae). Cristae contain most of the enzymes for electron transport system. Inner chamber of the mitochondrion is filled with proteinaceous material called mitochondrial matrix. The inner membrane consists of stalked particles called elementary particles or Fernandez Moran particles. F₁ particles or Oxysomes. Each particle consists of a base, stem and a round head. In the head ATP synthase is present for oxidative phosphorylation. Inner membrane is impermeable to most ions, small molecules and maintains the proton gradient that drives oxidative phosphorylation.

Question 10.
Draw & describe the structure of Nucleus.
Answer:
Nucleus is an important unit of cell which control all activities of the cell. Nucleus holds the hereditary information. It is the largest among all cell organelles. It may be spherical, cuboidal, ellipsoidal or discoidal. It is surrounded by a double membrane structure called nuclear envelope, which has the inner and outer membrane. The inner membrane is smooth without ribosomes and the outer membrane is rough by the presence of ribosomes and is continues with irregular and infrequent intervals with the endoplasmic reticulum.

The membrane is perforated by pores known as nuclear pores which allows materials such as mRNA, ribosomal units, proteins and other macromolecules to pass in and out of the nucleus. The pores enclosed by circular structures called annuli. The pore and annuli forms the pore complex. The space between two membranes is called perinuclear space. Nuclear space is filled with nucleoplasm, a gelatinous matrix has uncondensed chromatin network and a conspicuous nucleoli. The chromatin network is the uncoiled, indistinct and remain thread like during the interphase. It has little amount of RNA and DNA bound to histone proteins in eukaryotic cells.

Question 11.
Write in detail about the 3 types of centromere in eukaryotes.
Answer:
There are three types of centromere in Eukaryotes. They are as follows:

1. Point Centromere: The type of centromere in which the kinetochore is assembled as a result of protein recognition of specific DNA sequences. Kinetochores assembled on point centromere bind a single microtubule. It is also called as localized centromere. It occurs in budding yeasts.
2. Regional Centromere: In regional centromere where the kinetochore is assembled on a variable array of repeated DNA sequences. Kinetochore assembled on regional centromeres bind multiple microtubules. It occurs in fission yeast cell, humans and so on.
3. Holocentromere: The microtubules bind all the along the mitotic chromosome. Example: Caenorbabditis elegans (transparent nematode) and many insects.

Question 12.
List the functions of Nucleus.
Answer:
Functions of the Nucleus:

1. Controlling all the cellular activities
2. Storing the genetic or hereditary information
3. Coding the information in the DNA for the production of enzymes and proteins.
4. DNA duplication and transcription takes place in the nucleus.
5. In nucleolus ribosomal biogenesis takes place.

Question 13.
Explain the structure and movement of Eukaryotic flagella.
Answer:
Structure: Eukaryotic Flagella are enclosed by unit membrane and it arises from a basal body. Flagella is composed of outer nine pairs of microtubules with two microtubules in its centre (9 + 2 arrangement). Flagella are microtubule projection of the plasma membrane. Flagellum is longer than cilium (as long as 200 m). The structure of flagellum has an axoneme made up microtubules and protein tubulin.

Movement: Outer microtubule doublet is associated with axonemal dynein which generates force for movement. The movement is ATP driven. The interaction between tubulin and dynein is the mechanism for the contraction of cilia and flagella. Dynein molecules uses energy from ATP to shift the adjacent microtubules. This movement bends the cilium or flagellum.

Question 14.
Describe the steps involved in cytologieal techniques.
Answer:
There are different types of mounting based on the portion of a specimen to be observed.

1. Whole mount: The whole organism or smaller structure is mounted over a slide and observed.
2. Squash: Is a preparation where the material to be observed is crushed/squashed onto a slide so as to reveal their contents. Example: Pollen grains, mitosis and meiosis in root tips and flower buds to observe chromosomes.
3. Smears: Here the specimen is in the fluid (blood and microbial cultures etc) are scraped, brushed or aspirated from surface of organ. Example: Epithelial cells.
4. Sections: Free hand sections from a specimen and thin sections are selected, stained and mounted on a slide. Example: Leaf and stem of plants.

Question 15.
Name any 5 common stains their colour & their affinity used in cytologieal studies.
Answer:
Common Stains used in Histochemistry

V. Higher Order Thinking Skills (HOTs)

Question 1.
What makes the plant cell more rigid than animal cells?
Answer:
Plants cells posses cell wall which provides sufficient rigidity and proper shape to them whereas in case of animal cells, cell wall is totally absent.

Question 2.
Cleaning organelle in the cell – Explain.
Answer:
Lysosomes contains a variety of hydrolytic enzymes, which can digest the materials within the cell. Thus lysosomes act as cleaning organelle of the cell.

Question 3.
Ribosomes are single membrane organelles present in both prokaryotes & eukaryotes. List out the sites where ribosomes are present in plant cell.
Answer:
The sites where ribosomes are present in plant cell:

1. Cytoplasm
2. On rough endoplasmic reticulum
3. Inside mitochondira & chloroplast.

Question 4.
What does ‘S’ refer in a 70 S and an 80 S ribosomes?
Answer:
‘S’ refers to Svedberg units named after Theoder Svedberg. The size of ribosome and their subunits are represented by Svedberg unit.

Question 5.
Briefly give the contributions of the following scientists in the field of cytology.
(a) Schleiden and Schwann
(b) Singer and Nicolson
Answer:
(a) Schleiden and Schwann proposed the cell theory.
(b) Singer & Nicolson proposed the fluid mosaic model of plasmomembrane.

Question 6.
Is extra genomic DNA is present in prokaryotes & Eukaryotes? If yes, locate them in both the types of organisms.
Answer:
Locate them in both the types of organisms:

1. In prokaryotes like bacteria, plasmids are the extra genomic DNA present in cytoplasm.
2. In Eukaryotes, the circular DNA present in matrix of mitochondria & chloroplast are extragenomic DNA.

Question 7.
Give possible reasons to call mitochondria & chloroplast as semi – autonomous organelles.
Answer:
Mitochondria & chloroplasts are considered as semi – autonomoius organelle due to following
facts.

1. Both mitochondria & chloroplasts have their own DNA, which can replicate independently.
2. They have their own ribosomes by which they self-synthesize same of their proteins without depending on cellular DNA.

Students can Download Computer Science Chapter 1 Introduction to Computers Questions and Answers, Notes Pdf, Samacheer Kalvi 11th Computer Science Book Solutions Guide Pdf helps you to revise the complete Tamilnadu State Board New Syllabus and score more marks in your examinations.

Tamilnadu Samacheer Kalvi 11th Computer Science Solutions Chapter 1 Introduction to Computers

Samacheer Kalvi 11th Computer Science Introduction to Computers Text Book Back Questions and Answers

PART – 1
I. Choose The Correct Answer

Question 1.
First generation computers used ………………
(a) Vacuum tubes
(b) Transistors
(c) Integrated circuits
(d) Microprocessors
Answer:
(a) Vacuum tubes

Question 2.
Name the volatile memory.
(a) ROM
(b) PROM
(c) RAM
(d) EPROM
Answer:
(c) RAM

Question 3.
Identify the output device ………………
(a) Keyboard
(b) Memory
(c) Monitor
(d) Mouse
Answer:
(c) Monitor

Question 4.
Identify the input device ………………
(a) Printer
(b) Mouse
(c) Plotter
(d) Projector
Answer:
(b) Mouse

Question 5.
……………… Output device is used for printing building plan, flex board, etc.
(a) Thermal printer
(b) Plotter
(c) Dot matrix
(d) inkjet printer
Answer:
(b) Plotter

Question 6.
Which one of the following is used in ATM machine?
(a) Touch Screen
(b) speaker
(c) Monitor
(d) Printer
Answer:
(a) Touch Screen

Question 7.
When a system restarts, which type of booting is used.
(a) Warm booting
(b) Cold booting
(c) Touch boot
(d) Real boot
Answer:
(a) Warm booting

Question 8.
Expand POST ……………….
(a) Post on self Test
(b) Power on Software Test
(c) Power on Self Test
(d) Power on Self Text
Answer:
(c) Power on Self Test

Question 9.
Which one of the following is the main memory?
(a) ROM
(b) RAM
(c) Flash drive
(d) Hard disk
Answer:
(b) RAM

Question 10.
Which generation of computer used IC’s?
(a) First
(b) Second
(c) Third
(d) Fourth
Answer:
(c) Third

PART – 2
II. Short Answers

Question 1.
What is a computer?
Answer:
Computer is an Electronic Machine, capable of performing basic operations like addition, multiplication, division etc. Computer accepts data as input, process it, produce output and stores it for future.

Question 2.
Distinguish between data and information.
Answer:
Data:

• Data is a collection of facts from which the information may be derived. It is an unprocessed collection of facts in a manner suitable for communication, interpretation or processing.
• Example: 134, 16, Kavitha Does not give meaning.

Information:

• Information is a collection of facts from the conclusions can be drawn. Information is a processed facts, active, Business based and transformed from data.
• Example: Kavitha is 16 years old. Conveys meaning.

Question 3.
What are the components of a CPU?
Answer:
The Components of CPU are:

1. Control Unit
2. Arithmetic and Logic Unit (ALU)
3. Memory Unit.

Question 4.
What is the function of an ALU?
Answer:
The ALU is a part of CPU where various computing functions are performed on data. ALU performs arithmetic operations such as addition, subtraction, multiplication, division and logical operations.

Question 5.
Write the functions of control unit.
Answer:
The control unit controls the flow of data between the CPU, memory I/O devices. It also controls the entire operations of a computer.

Question 6.
What is the function of memory?
Answer:
Memory enables the computer to store the program. The memory unit is of two types:

1. Primary memory
2. Secondary memory

The primary memory is used to store data temporarily and secondary memory stores the data permanently.

Question 7.
Differentiate Input and output unit.
Answer:
Input unit:

• An input device feeds information to a computer system for processing.
• Input devices only allow for input of data to a computer.
• It is a peripheral device used to provide data and control signals to an information processing system such as computer.
• Example: keyboard, mouse.

Output unit:

• Output device reproduces or displays the results of that processing.
• Output devices only receive the output of data from another device.
• It is a unit which sends data from the computer to another device.
• Example: printer, monitor.

Question 8.
Distinguish Primary and Secondary memory.
Answer:
Primary Memory:

• It is directly accessed by CPU.
• The access of memory is done by making use of addresses or data buses.
• The Primary memory is embedded with 2 types of technologies. They are RAM and ROM.
• Volatile in nature.
• Much faster than the secondary Memory.
• Costlier than secondary memory.
• It is temporary memory.

Secondary Memory:

• It is not directly accessed by CPU.
• Here the Memory access is done through the input and output channels.
• The secondary memory are stored in mass storage units like CD ROM, CD, DVD, Floppy disk storage.
• Non – Volatile in nature.
• Slower than the Primary Memory.
• Cheaper than the Primary Memory.
• Secondary memory is permanent.

PART – 3
III. Explain in Brief

Question 1.
What are the characteristics of a computer?
Answer:
The Basic characteristics of the computers are:

1. High speed
2. Stores Huge Data
3. They do millions of different tasks
4. Very versatile
5. Accurate
6. Diligence

Question 2.
Write the applications of computer.
Answer:
Applications of Computer: Banking, Insurance, Education, Marketing, Health care, Engineering design, Communication, Government, Weather forecasting.

Question 3.
What is an input device? Give two examples.
Answer:
Input Device: It is a peripheral device used to provide data and control signals to an information processing system.
Example: Keyboard, Mouse, Scanners, Digital cameras, Joysticks.

Question 4.
Name any three output devices.
Answer:
The three output devices are (a) Plotter (b) Speakers (c) Multimedia Projector.

Question 5.
Differentiate optical and Laser mouse
Answer:
Optical Mouse:

• It is less sensitive towards the surface
• Tracking power is less
• Old technology
• This uses the light source instead of ball to judge the motion of the pointer
• Optical mouse has 3 buttons

Laser Mouse:

• Highly sensitive
• Tracking power is more
• Latest technology
• This uses Laser light
• No. of buttons will vary from 3 to many

Question 6.
Write short note on impact printer.
Answer:

1. Impact printer refers to the class of printers that work by banging a head or needle against an ink ribbon to make a mark on the paper.
2. Impact printers are very noisy.
3. These printers can print on multi-part.
4. Example: Dot Matrix, Line printers.

Question 7.
Write the characteristics of sixth generation.
Answer:

1. Natural Language Processing
2. Development of Robotics
3. Parallel and Distributed computing
4. Artificial Intelligence
5. Development of Robotics

Question 8.
Write the significant features of monitor.
Answer:

1. A computer monitor is an output device which displays information in pictorial form.
2. Monitors can be of monochrome which displays text or images in Black and white (or) in color.
3. Different types of monitors are CRT, LCD and LED.

PART – IV

Question 1.
Explain the basic components of a computer with a neat diagram.
Answer:
(i) Basic components of Computer:

The Basic components are I/O Unit, CPU, ALU, Control Unit, Storage Unit.

Input unit:
Input unit is used to feed any form of data to the computer. It can be stored in the memory unit for further processing.
Ex. Keyboard, Mouse, Scanner, Retinal scanner, Track ball.

Central processing unit:
CPU is the major component and it controls the operation of all other components such as memory, input and output units. The CPU has three components namely control unit, Arithmetic and logic unit (ALU) and memory unit.

Arithmetic and logic unit:
The ALU is a part of the CPU where arithmetic operations like addition, subtraction, multiplication, divisions and logical operations will takes place.

Control unit:
The control unit controls the flow of data between the CPU, memory and I/O devices. It also f controls the entire operation of a computer.

Output unit:
An output device is a hardware component that conveys information to the user in an understandable form.
Example: Monitor, printer, plotter

Memory unit:
The memory stores everything that computer works with. The memory unit is of two types namely primary memory and secondary memory. The primary memory stores the data and instructions temporarily. Whereas the secondary memory stores the data permanently. The primary memory is volatile and secondary memory is non – volatile.

Question 2.
Discuss the various generations of computers.
Answer:

Question 3.
Explain the following
(a) Inkjet Printer
(b) Multimedia projector
(c) Bar code / QR code Reader
Answer:
(a) Inkjet Printer:

1. Inkjet printer use colour cartridges which combined magenta, yellow and cyan inks to create colour tones.
2. A black cartridge is used for monochrome output. Inkjet printer works by spraying ionised ink at a sheet of paper.
3. The speed of inkjet printers generally range from 1 – 20 ppm (page per minute).
4. An inkjet printer can spread millions of dots of ink at the paper every single second.
5. They use the technology of firing ink by heating it so that it explodes towards the paper in bubbles or by using piezo electricity in which tiny electric currents are controlled by electronic circuits.

(b) Multimedia Projector:

1. Multimedia projectors are used to produce computer output on a big screen.
2. These are used to display presentations in meeting halls or in class rooms.

(c) Barcode/ QR code Reader:

1. A Bar code is a pattern printed in lines of different thickness.
2. The Bar code reader scans the information on the bar codes transmits to the computer for further processing.
3. The system gives fast and error free entry of information into the computer.

Quick response (QR) code: The QR code is the two dimension bar code which can be read by a camera and processed to interpret the image.

Samacheer kalvi 11th Computer Science Introduction to Computers Additional Questions and Answers

PART – 1
I. Choose the correct answer

Question 1.
Natural language processing is a component of ………………
(a) ULSI
(b) AI
(c) ENIAC
(d) OCR
Answer:
(b) AI

Question 2.
Computer is an ……………… device.
(a) Electrical
(b) Electronic
(c) Digital
(d) Memory
Answer:
(b) Electronic

Question 3.
Main component of second generation ………………
(a) vacuum tubes
(b) microprocessor
(c) integrated circuits
(d) transistor
Answer:
(d) transistor

Question 4.
Microprocessor is the component of ……………… generation.
(a) first
(b) fourth
(c) third
(d) all the above
Answer:
(b) fourth

Question 5.
Period of fourth generation ………………
(a) 1975 – 1980
(b) 1964 – 1975
(c) 1955 – 1964
(d) 1942 – 1955
Answer:
(a) 1975 – 1980

Question 6.
Hardware is the ……………… component of a computer.
(a) physical
(b) electrical
(c) electronic
(d) user
Answer:
(a) physical

Question 7.
Which word can be related to the inkjet printer ………………
(a) Airlines
(b) Piezo – electricity
(c) matrix
(d) plotter
Answer:
(b) Piezo – electricity

Question 8.
The printing speed of Impact printers varies from ………………
(a) 40 to 1540 CPS
(b) 50 to 150 CPS
(c) 90 to 1500 CPS
(d) 30 to 1550 CPS
Answer:
(d) 30 to 1550 CPS

Question 9.
Which printer using the carbon papers ………………
(a) laser printer
(b) non – impact printers
(c) Impact printer
(d) all the above
Answer:
(c) Impact printer

Question 10.
The speed of inkjet printers generally range from ………………
(a) 1 – 20 PPM
(b) 1 – 22 PPM
(c) 10 – 20 PPM
(d) 11 – 20 PPM
Answer:
(a) 1 – 20 PPM

Question 11.
Retinal scanner uses the technique of ………………
(a) GUI
(b) UI
(c) Biometric
(d) None of these
Answer:
(c) Biometric

Question 12.
Biometric technique followed by ………………
(a) printer
(b) plotter
(c) finger print scanner
(d) OCR
Answer:
(c) finger print scanner

Question 13.
The components of CPU ………………
(a) control unit
(b) ALU
(c) Memory unit
(d) all the above
Answer:
(d) all the above

Question 14.
The primary memory is embedded with ……………… types of technologies.
(a) 2
(b) 3
(c) 5
(d) 7
Answer:
(a) 2

Question 15.
Computer monitor displays the information in the form of ……………….
(a) vertical
(b) pictorial
(c) horizontal
(d) numeric
Answer:
(b) pictorial

Question 16.
Processed data is ………………
(a) information
(b) primary data
(c) data
(d) message
Answer:
(a) information

Question 17.
Who invented analytical engine?
(a) Charles Babbage
(b) John von Newman
(c) Blaise pascal
(d) Dennis Richard
Answer:
(a) Charles Babbage

Question 18.
Assembly language was introduced in which computer generation?
(a) First
(b) Second
(c) Third
(d) Fourth
Answer:
(b) Second

Question 19.
In which generation UNIVACI was used?
(a) First
(b) Second
(c) Third
(d) Fourth
Answer:
(a) First

Question 20.
1 BM 1401 belongs to which computer generation?
(a) First
(b) Second
(c) Third
(d) Fourth
Answer:
(b) Second

Question 21.
IBM 1620 belongs to which computer generation of computers?
(a) I
(b) II
(c) III
(d) IV
Answer:
(b) II

Question 22.
UNIVAC 1108 belongs to which generation?
(a) First
(b) Third
(c) Second
(d) Fourth
Answer:
(c) Second

Question 23.
Honeywell 6000 series belongs to ……………… generation.
(a) First
(b) Second
(c) Third
(d) Fourth
Answer:
(c) Third

Question 24.
Which is the first fully functional electronic computer?
(a) EBSAC
(b) ENIAC
(c) EDSAC
(d) EDIAC
Answer:
(b) ENIAC

Question 25.
NLP is a component of ………………
(a) AI
(b) Hardware
(c) Circuit
(d) Electronics
Answer:
(a) AI

Question 26.
Which is a raw fact about an entity?
(a) Information
(b) Processed data
(c) data
(d) record
Answer:
(c) data

Question 27.
Which input device is a pointing device?
(a) Keyboard
(b) Monitor
(c) Mouse
(d) Scanner
Answer:
(c) Mouse

Question 28.
Which controls the entire operation of a computer?
(a) ALU
(b) CU
(c) BUS
(d) I/O unit
Answer:
(b) CU

Question 29.
Arithmetic and logical computation are done by ………………
(a) CU
(b) ALU
(c) BUS
(d) memory
Answer:
(b) ALU

Question 30.
Which of the following stores the instructions and data?
(a) ALU
(b) CU
(c) BUS
(d) memory
Answer:
(d) memory

Question 31.
Which conveys information to the user in an understandable form?
(a) Input unit
(b) CU
(c) Output unit
(d) Bus
Answer:
(c) Output unit

Question 32.
Which is a volatile memory?
(a) Primary memory
(b) Secondary memory
(c) ROM
(d) EPROM
Answer:
(a) Primary memory

Question 33.
CD – ROM, DVD – ROM, DVD – ROM are examples of which of the following memory.
(a) read / write
(b) volatile
(c) primary
(d) non – volatile
Answer:
(d) non – volatile

Question 34.
Hard disk. CD – ROM, DVD – ROM are examples of which of the following memory.
(a) read only
(b) primary
(c) secondary
(d) volatile
Answer:
(c) secondary

Question 35.
Which one of the following is true?
(a) The no. of keys in any keyboard is always the same.
(b) All keyboard have strictly has the same layout.
(c) All keyboards are wired keyboards.
(d) All keyboards have alphabet and numeric keys.
Answer:
(d) All keyboards have alphabet and numeric keys.

Question 36.
Caps lock key, Num lock key are ………………
(a) Functional keys
(b) Lock keys
(c) GUI keys
(d) Direction keys
Answer:
(b) Lock keys

Question 37.
Mechanical, optical and laser are types of which input device.
(a) Keyboard
(b) Mouse
(c) Scanner
(d) Printer
Answer:
(b) Mouse

Question 38.
Who invented mouse?
(a) Douglas Engelbart
(b) Blaise paseal
(c) Bill gates
(d) Eckert
Answer:
(a) Douglas Engelbart

Question 39.
Which one of the following mouse type has more than 3 bottons and can be programmed?
(a) Mechanical
(b) Optical
(c) Laser
(d) 3D
Answer:
(c) Laser

Question 40.
The non – impact printer using similar technology used by photo copier is ……………… printer.
(a) Inkjet
(b) dot matrix
(c) laser
(d) line matrix
Answer:
(c) laser

Question 41.
The device that reads the information directly into the computer’s memory and works like a Xerox machine is ………………
(a) plotter
(b) scanner
(c) touch screen
(d) track ball
Answer:
(b) scanner

Question 42.
The oinput device used to display computer output on big screen is ………………
(a) line matrix printer
(b) dot matrix printer
(c) multimedia projector
(d) monitor
Answer:
(c) multimedia projector

Question 43.
The output device similar to upside-down design of a mouse ………………
(a) laser mouse
(b) optical mouse
(c) mechanical mouse
(d) track ball
Answer:
(d) track ball

Question 44.
Which is false?
(a) Light pen is very easy to use and very accurate input device
(b) Mouse and light pen are pointing devices.
(c) Monochrome monitors do not display multiple colours.
(d) Retinal scanner and finger print scanner are used for security.
Answer:
(a) Light pen is very easy to use and very accurate input device

Question 45.
Which of the following uses biometrics and unique pattern of retinal blood vessels?
(a) Retinal track
(b) Finger print scanner
(c) Optical scanner
(d) Retinal scanner
Answer:
(d) Retinal scanner

Question 46.
Which input device is a pointing device?
(a) Keyboard
(b) Monitor
(c) light pen
(d) Scanner
Answer:
(c) light pen

Question 47.
The input device that detects characters printed or written on paper is ………………
(a) Voice input system
(b) Track ball
(c) Optical character reader
(d) 3D mouse
Answer:
(c) Optical character reader

Question 48.
……………… converts spoken words to machine-readable form.
(a) Voice input system
(b) Speaker
(c) Optical character reader
(d) Scanner
Answer:
(a) Voice input system

Question 49.
CCD stands for ………………
(a) Code Converting Device
(b) Code Change Device
(c) Change Code Device
(d) Charge Coupled Device
Answer:
(d) Charge Coupled Device

Question 50.
The input device in which 4 to 50 keys are arranged in the cluster.
(a) Keyboard
(b) Mouse keys
(c) Keyer
(d) Scanner
Answer:
(c) Keyer

Question 51.
……………… are picture elements.
(a) Picture Point
(b) Monitor
(c) Routers
(d) Pixels
Answer:
(d) Pixels

Question 52.
Match the following

(a) (4) (3) (1) (2)
(b) (1) (2) (3) (4)
(c) (2) (3) (1) (2)
(d) (1) (2) (4) (3)
Answer:
(a) (4) (3) (1) (2)

Question 53.
The ……………… printer use the same technology used by photo copier.
(a) Inkjet
(b) dot matrix
(c) line
(d) laser
Answer:
(d) laser

Question 54.
Which is the first step when you on the computer?
(a) Default application is executed
(b) BIOS starts
(c) Printer drivers are loaded
(d) Checks FAT
Answer:
(b) BIOS starts

Question 55.
Printer are of types.
(a) 2
(b) 3
(c) 4
(d) 5
Answer:
(a) 2

Question 56.
The two types of booting are ………………
(a) soft and hard
(b) warm and cold
(c) heavy and light
(d) standard and default
Answer:
(b) warm and cold

Question 57.
Who is considered to be the father of computers?
(a) Charles Babbage
(b) John Von Nuemann
(c) John Napier
(d) Dennis Ritchie
Answer:
(a) Charles Babbage

Question 58.
Analytify engine was developed in the year.
(a) 1827
(b) 1837
(c) 1847
(d) 1857
Answer:
(b) 1837

Question 59.
Who invented ENIAC?
(a) J. Presper Eckert
(b) J. Napier
(c) J. Van Nueman
(d) J. Mauchaley
Answer:
(a) J. Presper Eckert

Question 60.
Identify the computer which belongs to third generation?
(a) EDVAC
(b) ENIAC
(c) IBM 1620
(d) IBM 360
Answer:
(d) IBM 360

Question 61.
Which is used as a component of second generation computers?
(a) Vacuum Tubes
(b) Transistor
(c) IC
(d) VLSI
Answer:
(b) Transistor

Question 62.
Expand BIOS?
(a) Basic Input Output System
(b) Biased Input Output System
(c) Battery Input Output System
(d) Booting Input Output System
Answer:
(a) Basic Input Output System

Question 63.
Expand CPS.
(a) Correction Per Second
(b) Characters Per Second
(c) Calculations Per Second
(d) Cording Per Second
Answer:
(b) Characters Per Second

Question 64.
Expand ENIAC.
(a) Electronic Number Integrated Algebra Calculation
(b) Electronic Numerical Integrator and Calculator
(c) Electronic Null Interpreter and Compiler
(d) Electronic Null Interpreter and Compiler
Answer:
(b) Electronic Numerical Integrator and Calculator

Question 65.
Which is the first known calculating device?
(a) Slide rule
(b) Rotating wheel calculator
(c) Abacus
(d) Daisywheel
Answer:
(c) Abacus

Question 66.
Which component is used in second generation computers?
(a) Vacuum tubes
(b) Transistor
(c) IC
(d) VLT
Answer:
(b) Transistor

Question 67.
Artificial Intelligence was introduced in which generation of computers?
(a) V
(b) II
(c) III
(d) IV
Answer:
(a) V

Question 68.
Match the following.

(a) (4) (3) (2) (1)
(b) (1) (2) (3) (4)
(c) (2) (3) (1) (2)
(d) (1) (2) (4) (3)
Answer:
(a) (4) (3) (2) (1)

Question 69.
In which generation of computers, NLP was developed?
(a) First
(b) Second
(c) Fifth
(d) Sixth
Answer:
(d) Sixth

Question 70.
Identify which is true?
(a) Portable computers were introduced in fourth generation.
(b) ULSI was used in the fifth generation.
(c) High level languages were used in HI generation.
(d) All the above statements are true.
Answer:
(d) All the above statements are true.

Question 71.
Expand NLP?
(a) Natural Language Processing
(b) Netural Language Processing
(c) New Laptop Processor
(d) New Language Processor
Answer:
(a) Natural Language Processing

Question 72.
OCR stands for ………………
(a) Optimal Compiler Recorder
(b) Optimal Character Recorder
(c) Optimum Charge Recorder
(d) Optimal Character Resolution
Answer:
(b) Optimal Character Recorder

Question 73.
Which is the meaning for the term computer?
(a) To estimate
(b) To calculate
(c) To connect
(d) To think
Answer:
(b) To calculate

Question 74.
Which is not a hardware component?
(a) Information
(b) Monitor
(c) Motherboard
(d) Keyboard
Answer:
(a) Information

Question 75.
What is the expansion of IPO?
(a) Input Process Output
(b) Internal Process Outsourcing
(c) Integrated program Output
(d) Integral project Output
Answer:
(a) Input Process Output

Question 76.
Identify the statement which is wrong?
(a) ALU performs addition, subtraction
(b) ALU controls flow of data between the CPU, memory and I/O devices
(c) Control unit controls the entire operation of computer
(d) The logical operation of ALU promotes the decision making
Answer:
(b) ALU controls flow of data between the CPU, memory and I/O devices

Question 77.
How many major classifications of memory are there?
(a) 2
(b) 3
(c) 4
(d) 5
Answer:
(a) 2

Question 78.
Which of the following input device scan the book?
(a) OMR
(b) OCR
(c) ECR
(d) OVR
Answer:
(b) OCR

Question 79.
Which of the folliwng is the two dimensional bar code?
(a) QR
(b) OCR
(c) OMR
(d) MICR
Answer:
(a) QR

Question 80.
Match the following.

(a) (4) (3) (1) (2)
(b) (1) (2) (3) (4)
(c) (1) (2) (4) (3)
(d) (4) (3) (2) (1)
Answer:
(a) (4) (3) (1) (2)

Question 81.
Which of the following input devices are classified as tactile, ergonomic, gaming?
(a) Keyboard
(b) Printer
(c) Monitor
(d) Mouse
Answer:
(d) Mouse

Question 82.
The main advantage of using the light pen is ……………….
(a) easy to use
(b) accurate
(c) easy to detect the characters
(d) drawing directly onto the screen
Answer:
(d) drawing directly onto the screen

Question 83.
When was the first computer monitor released?
(a) March 1, 1973
(b) March 1, 1972
(c) March 1, 1974
(d) March 1, 1970
Answer:
(a) March 1, 1973

Question 84.
The individual keys for letters, numbers and special characters are collectively called ………………. keys.
(a) character
(b) functional
(c) lock
(d) special
Answer:
(a) character

Question 85.
Which of the following device converts photographs into digital format?
(a) Digital camera
(b) Mouse
(c) Scanner
(d) Light pen
Answer:
(c) Scanner

Question 86.
Wired, wireless and virtual are the categories of ……………….
(a) mouse
(b) keyboard
(c) printer
(d) monitor
Answer:
(b) keyboard

Question 87.
Line printers can print how many lines per minute?
(a) 1500
(b) 1520
(c) 1000
(d) 1020
Answer:
(c) 1000

Question 88.
Which one of the following is the main characteristics of laser printer?
(a) Speed
(b) Resolution
(c) Reliability
(d) Durability
Answer:
(b) Resolution

Question 89.
Each dot in dot matrix printers produced by a tiny metal rod is called ……………….
(a) binary
(b) pixel
(c) resolution
(d) wire or pin
Answer:
(d) wire or pin

Question 90.
Expand DPI ……………….
(a) Dots Per Inch
(b) Dark Pen Ink
(c) Dark Page Ink
(d) Double Part ink
Answer:
(a) Dots Per Inch

PART – 2
II. Short Answers

Question 1.
Expand ANN, OCR
Answer:
ANN – Artificial Neural networks; OCR – Optical Character Recognition.

Question 2.
Name the different types of mouse available.
Answer:
Mechanical mouse, Optical mouse,-Laser mouse, Air mouse, 3D mouse, Tactile mouse, Ergonomic mouse and gaming mouse.

Question 3.
What are the advantages and disadvantages of light pen?
Answer:

1. Advantage: Drawing directly on to the screen.
2. Disadvantage: Hard to use and not accurate.

Question 4.
What is CCD?
Answer:
CCD is charge coupled device. Digital camera uses CCD electric chip. When light falls on the chip through the lens, it converts light rays into digital format.

Question 5.
Name some mouse actions.
Answer:
Move, click, double click, right click, drag and drop are some of the mouse actions.

Question 6.
Name the different types of keys available in the keyboard.
Answer:
Character keys, modifier keys, system and GUI keys, enter and editing keys, function keys, navigation keys, numeric keypad and lock keys.

Question 7.
What is NLP?
Answer:
NLP stands for Natural Language Processing which is a component of Artificial Intelligence (AI). It provides the ability to develop the computer program to understand human language.

Question 8.
Name the different types of monitors available.
Answer:
CRT (Cathode Ray Tube), LCD(Liquid Crystal Display), LED (Light Emitting Diode).

PART -2
III. Explain in Brief

Question 1.
Differentiate warm booting and cold booting?
Answer:
Cold Booting:
When the system starts from initial state i.e. it is switched on, we call it cold booting or Hard Booting. When the user presses the Power button, the instructions are read from the ROM to initiate the booting process.

Warm Booting:
When the system restarts or when Reset button is pressed, we call it Warm Booting or Soft Booting. The system does not start from initial state and so all diagnostic tests need not be carried out in this case. There are chances of data loss and system damage as the data might not have been stored properly.

Question 2.
Define non – impact printer.
Answer:
These printers do not use striking mechanism for printing. They use electrostatic or laser technology. Quality and speed of these printers are better than Impact printers. For example, Laser printers and Inkjet printers are non – impact printers.

Question 3.
Define Keyer?
Answer:
A Keyer is a device for signaling by hand, by way of pressing one or more switches. Modem keyers have a large number of switches but not as many as a full size keyboard. Typically, this number is between 4 and 50. A keyer differs from a keyboard, which has “no board”, but the keys are arranged in a cluster.

Question 4.
Write notes on Analytical Engine.
Answer:

1. Analytical engine was developed by Charles Babbage in 1837.
2. It has (a) Arithmetic Logic Unit (b) Basic Flow Control (c) Integrated memory.
3. The concept of Analytical engine led to the development of modem computers.

Question 5.
List out the input and output devices of a computer?
Answer:
Input Devices:

1. Keyboard
2. Mouse
3. Scanner
4. Fingerprint Scanner
5. Track Ball
6. Retinal Scanner
7. Light Pen
8. Optical Character Reader
9. Bar Code / QR Code Reader
10. Voice Input Systems
11. Digital Camera
12. Touch Screen
13. Keyer

Output Devices:

1. Monitor
2. Plotter
3. Printers

Question 6.
Explain the mechanism of laser mouse?
Answer:

1. Measures the motion and acceleration of pointer.
2. Laser Mouse uses Laser Light
3. Laser Mouse is highly sensitive and able to work on any hard surface.

Question 7.
Explain fingerprint scanner and retinal scanner?
Answer:
Fingerprint Scanner:
Finger print Scanner is a fingerprint recognition device used for computer security, equipped with the fingerprint recognition feature that uses biometric technology. Fingerprint Reader / Scanner is a very safe and convenient device for security instead of using passwords, which is vulnerable to fraud and is hard to remember.

Retinal Scanner:
This performs a retinal scan which is a biometric technique that uses unique patterns on a person’s retinal blood vessels.

Question 8.
Define touch screen?
Answer:
Touch Screen:
A touch screen is a display device that allows the user to interact with a computer by using the finger. It can be quite useful as an alternative to a mouse or keyboard for navigating a Graphical User Interface (GUI). Touch screens are used on a wide variety of devices such as computers, laptops, monitors, smart phones, tablets, cash registers and information kiosks. Some touch screens use a grid of infrared beams to sense the presence of a finger instead of utilizing touch-sensitive input.

PART – 4
IV. Explain in Detail

Question 1.
What is mouse? And explain its types?
Answer:
Mouse:
Mouse (wired/wireless) is a pointing device used to control the movement of the cursor on the display screen.

Question 2.
Explain input devices of a computer?
Input Devices:
Keyboard : Keyboard (wired / wireless, virtual) is the most common input device used today. The individual keys for letters, numbers and special characters are collectively known as character keys. This keyboard layout is derived from the keyboard of original typewriter.

Mouse:
Mouse (wired/wireless) is a pointing device used to control the movement of the cursor on the display screen.

Types of Mouses:

1. Mechanical Mouse
2. Optical Mouse.
3. Laser Mouse

Scanner : Scanners are used to enter the information directly into the computer’s memory. This device works like a Xerox machine. The scanner converts any type of printed or written information including photographs into a digital format, which can be manipulated by the computer.

Track Ball : Track ball is similar to the upside – down design of the mouse. The user moves the ball directly, while the device itself remains stationary. The user spins the ball in various directions to navigate the screen movements.

Retinal Scanner : This performs a retinal scan which is a biometric technique that uses unique patterns on a person’s retinal blood vessels.

Light Pen : A light pen is a pointing device shaped like a pen and is connected to a monitor. The tip of the light pen contains a light-sensitive element which detects the light from the screen enabling the computer to identify the location of the pen on the screen. Light pens have the advantage of ‘drawing’ directly onto the screen, but this becomes hard to use, and is also not accurate.

Optical Character Reader : It is a device which detects characters printed or written on a paper with OCR, a user can scan a page from a book. The Computer will recognize the characters in the page as letters and punctuation marks and stores. The Scanned document can be edited using a word processor.

Bar Code / QR Code Reader : A Bar code is a pattern printed in lines of different thickness. The Bar code reader scans the information on the bar codes transmits to the Computer for further processing. The system gives fast and error free entry of information into the computer.

QR (Quick response) Code : The QR code is the two dimension bar code which can be read by a camera and processed to interpert the image

Voice Input Systems : Microphone serves as a voice Input device. It captures the voice data and send it to the Computer. Using the microphone along with speech recognition software can offer a completely new approach to input information into the Computer.

Digital Camera : It captures images / videos directly in the digital form. It uses a CCD (Charge Coupled Device) electronic chip. When light falls on the chip through the lens, it converts light rays into digital format.

Touch Screen : A touch screen is a display device that allows the user to interact with a computer by using the finger. It can be quite useful as an alternative to a mouse or keyboard for navigating a Graphical User Interface (GUI). Touch screens are used on a wide variety of devices such as computers, laptops, monitors, smart phones, tablets, cash registers and information kiosks. Some touch screens use a grid of infrared beams to sense the presence of a finger instead of utilizing touch – sensitive input.

Keyer : A Keyer is a device for signaling by hand, by way of pressing one or more switches. Modem keyers have a large number of switches but not as many as a full size keyboard. Typically, this number is between 4 and 50.

Students can Download Computer Applications Chapter 7 Looping Structure Questions and Answers, Notes Pdf, Samacheer Kalvi 12th Computer Applications Book Solutions Guide Pdf helps you to revise the complete Tamilnadu State Board New Syllabus and score more marks in your examinations.

Tamilnadu Samacheer Kalvi 12th Computer Applications Solutions Chapter 7 Looping Structure

Samacheer Kalvi 12th Computer Applications Looping Structure Text Book Back Questions and Answers

PART – I
I. Choose The Correct Answer

Question 1.
Most complicated looping structure is ……………………………
(a) While
(b) Do While
(c) For
(d) None of them
Answer:
(c) For

Question 2.
Loops that iterate for fixed number of times is called ………………………….
(a) Unbounded loops
(b) Bounded loops
(c) While loops
(d) For loops
Answer:
(b) Bounded loops

Question 3.
Which loop evaluates condition expression as Boolean, if it is true, it executes statements and when it is false it will terminate?
(a) For loop
(b) For each loop
(c) While loop
(d) All of them
Answer:
(d) All of them

Question 4.
Which loop evaluates condition expression as Boolean, if it is true, it executes statements and when it is false it will terminate?
(a) For loop
(b) For each loop
(c) While loop
(d) All of them
Answer:
(d) All of them

Question 5.
What will be displayed in a browser when the following PHP code is executed:
<?php
for (Scounter = 20; $counter< 10;
$counter++)
{
echo “Welcome to Tamilnadu “;
}
echo “Counter is: Scounter”;
?>
(a) Welcome to Tamilnadu
(b) Counter is: 20
(c) Welcome to Tamilnadu Counter is: 22
(d) Welcome to Tamilnadu Welcome to Tamilnadu Counter is: 22
Answer:
(b) Counter is: 20

Question 6.
What will be displayed in a browser when the following PHP code is executed:
<?php
for (Scounter = 10; Scounter = 10;
$counter = $counter + 5){
echo “Hello”;
}
?>
(a) Hello Hello Hello Hello Hello
(b) Hello Hello Hello
(c) Hello
(d) None of the above
Answer:
(d) None of the above

Question 7.
PHP supports four types of looping techniques?
(a) for loop
(b) while loop
(c) for each loop
(d) all the above
Answer:
(d) all the above

Question 8.
Consider the following code
<? php
$count=12;
do{
printf(“%d squared=%d<br/>”,
Scount, pow($count,2));
} while($count<4);
?>
What will be the output of the code.
(a) 12 squared 141
(b) 12 squared=141
(c) “12 squared=141”
(d) Execution error
Answer:
(d) Execution error

Question 9.
What will be the output of the following PHP code?
<?php
for ($x = 1; $x < 10;++$x)
{
print “*\t”;}
?>
(a) **********
(b) *********
(c) ***********
(d) Infinite loop
Answer:
(b) *********

Question 10.
What will be the output of the following PHP code?
<?php
for ($x =-1; $x < 10;–$x)
{
print $x;
}
?>
(a) 123456713910412
(b) 123456713910
(c) 1234567139104
(d) Infinite loop
Answer:
(d) Infinite loop

PART – II
II. Short Answer

Question 1.
Define Looping Structure in PHP?
Looping Structure:
Answer:

1. Looping Structures are useful for writing iteration logics.
2. It is the most important feature of many programming languages, including PHP.
3. They are implemented using the following categories,
   1. for Loop
   2. While Loop
   3. foreach Loop
   4. Do While Loop

Question 2.
Define for loop in PHP?
Answer:
For Loop:
For loop is an important functional looping system which is used for iteration logics when the programmer know in advance how many times the loop should run.
Syntax:
for (init counter; test counter; increment counter)
{
code to be executed;
}

Question 3.
What is For each loop in PHP?
Answer:
For each Loop:

1. for each loop is exclusively available in PHP.
2. It works only with arrays. The loop iteration deepens on each KEY Value pair in the Array.
3. For each, loop iteration the value of the current array element is assigned to $value variable and the array pointer is shifted by one, until it reaches the end of the array element.

Question 4.
List out Looping Structure in PHP?
Answer:

1. for Loop
2. While Loop
3. For each Loop
4. Do While Loop

Question 5.
Write Syntax of For loop in PHP?
Answer:
for (init counter; test counter; increment counter)
{
code to be executed;
}

Question 6.
Write Syntax of For each loop in PHP?
Answer:
for each ($array as $value)
{
code to be executed;
}

Question 7.
Write Syntax of while loop in PHP?
Answer:
while (condition is true)
{
code to be executed;
}

Question 8.
Write Syntax of Do while loop in PHP?
Answer:
do
{
code to be executed;
}
while (condition is true);

Question 9.
Compare For loop and for each loop?
Answer:
For loop:
The for loop is used when you know in advance how many times the script should run.

for each loop:
The for each loop works only on arrays, and is used to loop through each key/value pair in an array.

Question 10.
Usage of for each loop in PHP?
Answer:

1. The for each loop works only on arrays,
2. It is used to loop through each key/value pair in an array.

PART – III
III. Explain in Brief Answer

Question 1.
Write the features Looping Structure?
Looping Structure:
Answer:

1. Looping Structures are useful for writing iteration logics.
2. It is the most important feature of many programming languages, including PHP.
3. They are implemented using the following categories:
   1. For Loop
   2. For each Loop
   3. while Loop
   4. Do while Loop

1. For Loop:
For loop is an important functional looping system which is used for iteration logics when the programmer know in advance how many times the loop should run.
Syntax:
for (init counter; test counter; increment counter) {
code to be executed;
}

2. For each Loop:
foreach loop is exclusively available in PHP. It works only with arrays. The loop iteration deepens on each KEY Value pair in the Array. For each, loop iteration the value of the current array element is assigned to $value variable and the array pointer is shifted by one, until it reaches the end of the array element.
Syntax:
for each ($array as $value)
{
code to be executed;
}

3. While Loop:
While loop is an important feature which is used for simple iteration logics. It is checking the condition whether true or false. It executes the loop if specified condition is true.
Syntax:
while (condition is true)
{
code to be executed;
}

4. Do While Loop:
Do whileloop always run the statement inside of the loop block at the first time execution. Then it is checking the condition whether true or false. It executes the loop, if the specified condition is true.
Syntax: do
{
code to be executed;
}
while (condition is true);

Question 2.
Discuss in detail about For each loop?
Answer:
For each Loop:
foreach loop is exclusively available in PHP. It works only with arrays. The loop iteration deepens on each KEY Value pair in the Array. For each, loop iteration the value of the current array element is assigned to $value variable and the array pointer is shifted by one, until it reaches the end of the array element.
Syntax:
for each ($array as Svalue)
{
code to be executed;
}
The foreach construct provides an easy way to iterate over arrays, foreach works only on arrays and objects, and will issue an error when you try to use it on a variable with a different data type or an uninitialized variable.

Example:
<?php
$Student_name = array(“Magilan”, “Iniyan”,
“Nilani”, “Sibi”, “Shini”);
foreach (SStudent_name as $value)
{
echo “Svalue <br>”;
}
?>

Question 3.
Explain the process Do while loop?
Do While Loop:
Answer:
Do while loop always run the statement inside of the loop block at the first time execution. Then it is checking the condition whether true or false. It executes the loop, if the specified condition is true.

Syntax:
do
{
code to be executed;
}
while (condition is true);
Example:
<?php
$Student_count = 10;
$student_number=1;
do
{
echo “The student number is: $student_number<br>”;
$ student_number++;
}
while($student_number<= $Student_count)
?>

Question 4.
Explain concepts of for loop with example?
Answer:
For Loop:
For loop is an important functional looping system which is used for iteration logics when the programmer know in advance how many times the loop should run.

Syntax:
for Unit counter; test counter; increment counter)
{
code to be executed;
}

Parameters:

1. init counter: Initialize the loop initial counter value
2. Test counter: Evaluated for every iteration of the loop. If it evaluates to TRUE, the loop continues. If it evaluates to FALSE, the loop ends.
3. Increment counter: Increases the loop counter value.

Example:
<?php
for ($i = 0; $i<= 10; $i++)
{
echo “The number is: $i<br>”;
}
?>

Question 5.
Explain array concepts in Looping Structure?
Answer:
Foreach Loop:
for each loop is exclusively available in PHP. It works only with arrays. The loop iteration deepens on each KEY Value pair in the Array. For each, loop iteration the value of the current array element is assigned to $value variable and the array pointer is shifted by one, until it reaches the end of the array element.

Syntax:
for each ($array as Svalue)
{
code to be executed;
}
The for each construct provides an easy way to iterate over arrays, foreach works only on arrays Foreach loop Structure and Flow and objects, and will issue an error when you try to use it on a variable with a different data type or an uninitialized variable.
Example:
<?php
$Student_name = array(“Magilan”, “Iniyan”,
“Nilani”, “Sibi”, “Shini”);
foreach (SStudentname as Svalue) {
echo “Svalue <br>”;
}
?>

Samacheer Kalvi 12th Computer Applications Solutions Looping Structure Additional Question and Answer

1. Choose The Best Answer

Question 1.
………………………….. structures are useful for writing iteration logics.
Answer:
Looping

Question 2.
Which loop is used if you know in advance how many times the loop should run?
(a) For
(b) For each
(c) While
(d) Do-while
Answer:
(a) For

Question 3.
Find the true statement from the following.
(a) Init counter initialises the loop
(b) Increment counter initialises the loop
Answer:
(a) Init counter initialises the loop

Question 4.
Which counter decides whether the loop should continue or ends?
(a) Init
(b) Test
(c) Increment
(d) Decrement
Answer:
(b) Test

Question 5.
How many segments are there in a for loop?
(a) 1
(b) 2
(c) 3
(d) 4
Answer:
(c) 3

Question 6.
Pick the odd one out related to the parameters of the for loop?
(a) init
(b) test
(c) text
(d) Increment
Answer:
(c) text

Question 7.
How many types of loops are there?
(a) 1
(b) 2
(c) 3
(d) 4
Answer:
(d) 4

Question 8.
Each segment of the for loop is terminated by
(a) ,
(b) ;
(c) :
(d) .
Answer:
(b) ;

Question 9.
Which loop is exclusively available in PHP?
(a) For
(b) While
(c) for each
(d) do while
Answer:
(c) for each

Question 10.
Which of the following loop works only with arrays?
(a) for
(b) while
(c) for each
(d) do while
Answer:
(c) for each

Question 11.
Find the Incorrect statement
(I) For loop works only with arrays
(II) For each loop works only with arrays
Answer:
(I) For loop works only with arrays

Question 12.
Which one of the following loop has key value pair?
(a) for
(b) for each
(c) while
(d) do.while
Answer:
(b) for each

Question 13.
Assertion (A): In for each loop, the array pointer is shifted by one.
Reason (R): Whether it reaches the end of the array element
(a) A is True, R is correct But R is not correct explanation for A
(b) Assertion is True, Reason is False
(c) Assertion is false, Reason is true
(d) Assertion and Reason are correct and R is the correct reason for A.
Answer:
(d) Assertion and Reason are correct and R is the correct reason for A.

Question 14.
Find the Wrong statement
(a) For each works on arrays and pointers
(b) For each works on arrays
(c) For each works on arrays and objects .
(d) For each works on objects
Answer:
(a) For each works on arrays and pointers

Question 15.
Find the correct statement from the following.
(a) For each can be used for variables with a different data type
(b) For each can be used with uninitialized variable
(c) For each can be used for objects
Answer:
(c) For each can be used for objects

Question 16.
Which loop is used for simple iteration objects?
(a) For
(b) For each
(c) While
(d) do..while
Answer:
(c) While

Question 17.
Which one of the following loop will be executed atleast once?
(a) For
(b) For each
(c) While
(d) do..while
Answer:
(d) do..while

II. Short Answer

Question 1.
Explain about the parameters in the for loop?
Answer:
Parameters:

1. init counter: Initialize the loop initial counter value
2. Test counter: Evaluated for every iteration of the loop. If it evaluates to TRUE, the loop continues. If it evaluates to FALSE, the loop ends.
3. Increment counter: Increases the loop counter value.

Question 2.
Give the flow chart for For Loop?
Answer:

Question 3.
Write a php program to print the students name in the array?
Example:
Answer:
<?php
$Student_name = array(“Magilan”, “Iniyan”,
“Nilani”, “Sibi”, “Shini”);
foreach ($Studentname as $value) { echo “Svalue <br>”;
?>

Question 4.
Give the structure and flow for while loop?
Answer:

Question 5.
Give the structure and flow chart for dowhile loop?
Answer:

Question 6.
Write a php program to print star (*) in a single line?
Answer:
<?php
for ($x = 1; $x < 10;++$x)
{
print “*\t”;}
?>

III. Explain in detail

Question 1.
Explain While loop?
Answer:
While Loop:
While loop is an important feature which is used for simple iteration logics. It is checking the condition whether true or false. It executes the loop if specified condition is true.

Syntax:
while (condition is true) {
code to be executed;
}
Example:
<?php
$Student_count = 10;
$student_number=1;
while($student_number<= $Student_count)
{
echo “The student number is: $student_number<br>”;
$student_number++;
}
?>

Students can Download Computer Applications Chapter 12 DNS (Domain Name System) Questions and Answers, Notes Pdf, Samacheer Kalvi 12th Computer Applications Book Solutions Guide Pdf helps you to revise the complete Tamilnadu State Board New Syllabus and score more marks in your examinations.

Tamilnadu Samacheer Kalvi 12th Computer Applications Solutions Chapter 12 DNS (Domain Name System)

Samacheer Kalvi 12th Computer Applications DNS (Domain Name System) Text Book Back Questions and Answers

PART – I
I. Choose The Correct Answer

Question 1.
Which of the following is used to maintain all the directory of domain names?
(a) Domain name system
(b) Domain name space
(c) Name space
(d) IP address
Answer:
(a) Domain name system

Question 2.
Which of the following notation is used to denote IPv4 addresses?
(a) Binary
(b) Dotted-decimal
(c) Hexadecimal
(d) a and b
Answer:
(d) a and b

Question 3.
How many bits are used in the IPv6 addresses?
(a) 32
(b) 64
(c) 128
(d) 16
Answer:
(c) 128

Question 4.
Expression ion of URL is
(a) Uniform Resource Location
(b) Universal Resource Location
(c) Uniform Resource Locator
(d) Universal Resource Locator
Answer:
(c) Uniform Resource Locator

Question 5.
How many types are available in Relative URL?
(a) 2
(b) 3
(c) 4
(d) 5
Answer:
(b) 3

Question 6.
Maximum characters used in the label of a node?
(a) 255
(b) 128
(c) 63
(d) 32
Answer:
(c) 63

Question 7.
In domain name, sequence of labels are separated by
(a) ;
(b) .(dot)
(c) :
(d) NULL
Answer:
(b) .(dot)

Question 8.
Pick the odd one out from the following.
(a) node
(b) label
(c) domain
(d) server
Answer:
(d) server

Question 9.
Which of the following initiates the mapping of domain name to IP address?
(a) Zone
(b) Domain
(c) Resolver
(d) Name servers
Answer:
(c) Resolver

Question 10.
Which is the contiguous area up to which the server has access?
(a) Zone
(b) Domain
(c) Resolver
(d) Name servers
Answer:
(a) Zone

Question 11.
ISP stands for
(a) International Service provider
(b) Internet Service Provider
(c) Internet service Protocol
(d) Index service provider
Answer:
(b) Internet Service Provider

Question 12.
TLD stands for
(a) Top Level Data
(b) Top Logical Domain
(c) Term Level Data
(d) Top Level Domain
Answer:
(d) Top Level Domain

Question 13.
Which of the following statements are true?
(i) Domains name is a part of URL.
(ii) URL made up of four parts
(iii) The relative URL is a part of Absolute URL
(iv) URL doesn’t contain any protocol
(a) (i) & (ii)
(b) (ii)
(c) (i), (ii) & (iii)
(d) i, (ii) & (iv)
Answer:
(c) (i), (ii) & (iii)

Question 14.
Assertion(A) :The number of addresses used in IPv6 addressing method is 128.
Reason (R): IPv6 address is a 128 bit unique address.
(a) A is true and R is false.
(b) A is false and R is true.
(c) Both A and R are correct and R is the correct explanation of A.
(d) Both A and R are correct and R is not the correct explanation of A.
Answer:
(b) A is false and R is true.

Question 15.
Match the following
(i) domian – 1. progress that initiates trAnswer:lation
(ii) Zone – 2. contains database of domain names
(iii) name server – 3. single node
(iv) resolver – 4. contiguous nodes
(a) (i)-1 (ii)-4 (iii)-3 (iv)-2
(b) (i)-3 (ii)-4 (iii)-2 (iv)-1
(c) (i)-3 (ii)-2 (iii)-1 (iv)-4
(d) (i)-3 (ii)-4 (iii)-1 (iv)-2
Answer:
(b) (i)-3 (ii)-4 (iii)-2 (iv)-1

PART – II
II. Short Answer

Question 1.
List any four domain names?
Answer:
Domain Name:

1. com
2. edu
3. gov
4. mil

Meaning:

1. Commercial Organisation
2. Educational Institution
3. Government (US)
4. Military groups

Question 2.
What is an IP address?
Answer:
Internet Protocol (IP) address is simply the logical address in the network layer. Like how the door number/flat number is used to differentiate individual house from others in the same apartment IP address is also used to find the host system in the whole network.

Question 3.
What are the types of IP address?
Answer:

1. IPv4 Address and
2. IPv6 Address

Question 4.
What is an URL?
Answer:

1. URL (Uniform Resource Locator) is the address of a document on the Internet.
2. URL is made up four parts-protocols, hostname, folder name and file name.
3. Each part has its own specific functions.

Question 5.
List out four URLs you know?
Answer:
URL:

1. http: //www. example.com/index, html
2. http://www.computer.com
3. http://www.ibm.com
4. https://www.hellotravel.com

Question 6.
What are the types of URL?
Answer:

1. URL (Uniform Resource Locator) is the address of a document on the Internet.
2. URL is divided into two types: Absolute URL and Relative URL

Question 7.
What is a domain?
Answer:

1. A domain is a single node of the Domain Namespace.
2. In the domain name space (DNS) tree structure domain is a sub structure tree. The domain can be further divided into sub domains.

Question 8.
What is a zone?
Answer:

1. It is the area up to which the server has access.
2. Zone is defined as a group of contiguous domains and sub domains. If the zone has a single domain, then zone and domain are the same.

Question 9.
What is a resolver?
Answer:

1. The resolver is a program which is responsible for initiating the trAnswer:lation of a domain name into an IP address.
2. Since a resolver is stored in the host, there is no need of any protocol to form a connection between the resolver and the user program.

Question 10.
What are the categories available in domain name space?
Answer:
There are 3 important components in the Domain Name System. They are Namespace, Name server and Zone.

Question 11.
Write any four generic Top Level Domain?
Answer:
Domain Name:

1. com
2. edu
3. gov
4. mil

Meaning:

1. Commercial Organisation
2. Educational Institution
3. Government (US)
4. Military groups

PART – III
III. Explain in Brief Answer

Question 1.
Write a note on DNS?
Answer:
Domain Name System (DNS) maintains all the directory of domain names/host names and help us to access the websites using the domain/host names. To enable the use of domain names in a network, the Domain Name System (DNS) is used.

Question 2.
Differentiate IPv4 and IPv6?
Answer:
IPv4:

1. IPv4 address is a 32 bit unique address given to a computer system
2. The number of address that can be formed is 232
3. It is represented by Binary notation Dotted-decimal notation

IPv6:

1. IPv6 address is a 128 bit unique address given to a computer system
2. The number of addresses formed in IPv6 is 2128
3. It is represented by 4 digit Hexadecimal numbers.

Question 3.
Differentiate Domain name and URL?
Answer:
Domain name:

1. Domain name is the trAnswer:lated and simpler form of IP address
2. Part of URL
3. It is subdivided into subdomains eg, .in, .uk

URL:

1. URL is the full web address used to locate a webpage
2. Complete web address including domain names.
3. It is divided into method domain name, port, path www.ibm.com

Question 4.
What are the differences between Absolute URL and Relative URL?
Answer:
Absolute URL:

1. Absolute URL is the complete address of a document on the Internet.
2. Absolute URL contains all the information that are required to find the files on the . Internet.
3. If any of the four parts is missing then the browser would not able to link to the specific file. So, all the four parts is very important in absolute URL.

Relative URL:

1. Relative URL is the partial address of a document on the Internet.
2. Relative URL contains only file name or file name with folder name.
3. We can use this type of URL when the file is on the same server related to original document.

Question 5.
Write a note on domain name?
Answer:

1. Domain name is the sequence of labels. In domain name the sequence of labels are separated ‘ by dot (.).
2. The domain name is always read from the lower level to higher level i.e., from the leaf node to root node.
3. Since the root node always represent NULL string, all the domain name ending with dot.

Question 6.
Differentiate web address and URL?
Answer:
Web Address:

1. A Web Address more commonly defines a unique name that helps people remember a URL
2. It is usually in simpler form such as Amazon.com
3. Generally your browser will recognize the proper URL when you type in a web address

URL:

1. URL stands for Uniform Resource Locator. A is the address of a particular website, audio stream or document available on the web
2. URL’s consist of the Internet protocol needed to access the item you wish to locate on the host computer.

PART – IV
IV. Explain in detail

Question 1.
Explain briefly the components of DNS?
Answer:
DNS Components:
There are three important components in the Domain Name System. They are:

1. Namespace
2. Name server
3. Zone

1. Name Space:

• The domain names must be very unique and appropriate. The names should be selected from a namespace.
• The name space can be organized in two ways
• Flat name space
• Hierarchical name space
• Flat name space is where the name is assigned to the IP address. They do not have any specific structure.
• Hierarchical name space is where the name is made up of several parts. The first part may represent the nature of organization, the second part may represent the name of organization, and third part may represent the department of the organization.
• Domain name space was designed to achieve hierarchical name space.

2. Name Servers:

• The information which needs to be stored in Domain name space is quite large. Single system would be inefficient to store such a huge amount as responding to requests from all over the world. It also becomes unreliable because in case of any failure the data becomes inaccessible.
• Name Server is a main part in the Domain Name System (DNS). It trAnswer:late the domain names to IP addresses.
• Name server contains the DNS database which consists of domain names and their corresponding IP addresses.
• There is a need to store large number of domain names for the world wide usage, so plenty of servers are used in the hierarchical manner.
• Name servers do the important task of searching the domain names. While you searching a website, Local Name server (provided by ISP) ask the different name servers until one of them find out your Answer:wer. At last it returns IP address for that domain name.

3. Zone:

• The entire name space is divided into many different zones. It is the area up to which the server has access.
• Zone is defined as a group of contiguous domains and sub domains. If the zone has a single domain, then zone and domain are the same.
• Every zone has the server which contains a database called zone file. Using the zone file, the DNS server replies the queries about hosts in its zone. There are two copies of zone files available, Master file and slave file.

Question 2.
Classify and Explain the IP address?
Answer:
IP Address:
Internet Protocol (IP) address is simply the logical address in the network layer. Like how the door number/flat number is used to differentiate individual house from others in the same apartment IP address is also used to find the host system in the whole network. Due to increase in the number of system in a network there is a need of more addresses which lead to two addressing methods i.e., IPv4 and IPv6.

IPv4 Address:
1. IPv4 address is a 32-bit unique address given to a computer system. No two systems can have same IP address.

2. If the network has p connections then ‘ p’ addresses should be there.

3. An address space is the total number of addresses that can be made by that protocol. It is determined by the number of bits that the protocol use.

4. If the protocol uses ‘n’ bits then the address space of that protocol would be ‘2n’ addresses can be formed. So, the number of addresses that can be formed in IPv4 is 232.

5. There are two ways to represent the IP address – Binary notation

Dotted-decimal notation:
In binary notation the address is expressed as 32-bit binary values.
For E.g. 00111001 10001001 00111000 00000111
In dotted-decimal notation the address is written in decimal format separated by dots(.). For e.g. 128.143.137.144

IPv6 Address:
1. IPv6 address is a 128-bit unique address given to a computer system. The number of addresses that can be formed in IPv6 is 2128.

2. In IPv6 address, the 128 bits are divided into eight 16-bits blocks.

3. Each block is then changed into 4-digit Hexadecimal numbers separated by colon symbols. E.g. 2001:0000:32313:DFE1:0063:0000:0000:FEFB.

Question 3.
Explain about the name server?
Answer:
Name Servers:
1. The information which needs to be stored in Domain name space is quite large. Single system would be inefficient and insufficient to store such a huge amount as responding to requests from all over the world. It also becomes unreliable because in case of any failure the data becomes inaccessible.

2. The solution to this problem is to distribute the information among many computers. The best way to do that is to divide the entire space into many domains and sub domains

3. DNS also allows domains to be further divided into sub domains. By this, the solution to the problem is obtained and hierarchy of servers is also maintained.

4. Name servers store the data and provide it to clients when queried by them. Name Servers are programs that run on a physical system and store all the zone data.

5. Name Server is a main part in the Domain Name System (DNS). It translate the domain names to IP addresses.

6. Name server contains the DNS database which consists of domain names and their corresponding IP addresses.

7. There is a need to store large number of domain names for the world wide usage, so plenty of servers are used in the hierarchical manner.

8. Name servers do the important task of searching the domain names. While you searching a website, Local Name server (provided by ISP) ask the different name servers until one of them find out your Answer:wer. At last it returns IP address for that domain name.

Types of Name Servers
There are three types of Name Servers which control the entire Domain Name System:
(i) Root Name Server – top level server which contains entire DNS tree, maintained by ICANN.
There are 13 servers.

(ii) Primary/Master Name Server – contains a zone resource records. These records are updatable by domain name holders such as organizations.

(iii) Secondary/Slave Name Server – contains a copy of primary server files. This server has no authority to update, but reduce the workload of master server by sharing the queries.

Question 4.
What is domain name space? Explain?
Answer:
Domain Name Space:
Domain name space was designed to achieve hierarchical name space. In this, the names are represented as a tree like structure with root element on the top and this tree can have a maximum of 128 levels starting from root element taking the level 0 to level 127.

This diagram represent the domain name space where the root element is present at the top most level i.e., level 0. The root element always represents the NULL string (empty, string). The next level to the root element is node (children of root element). Each node in the tree has a label and a domain name.

Label:

1. It is a string which can have maximum of 63 characters.
2. Each node in that level should have different labels thereby assuring the individuality of the domain name.
3. In other words, Labels are the names given to domains.
4. Domain is a sub tree in domain name space tree structure. The domain can be further divided into sub domains.

Domain name:
It is the sequence of labels. In domain name the sequence of labels are separated by dot (.).

Question 5.
Explain how the DNS is working?
Answer:
1. When the user enters the URL (consists of protocol, domain name, folder name, file name) in the browser, the system fist checks its DNS cache for the corresponding IP address.

2. If the IP address is found in the cache then the information is retrieved from cache.

3. If not, then the system needs to perform DNS query i.e., the system needs to query the resolver about the IP address from Internet Service Provider (ISP).

4. Each resolver has its own cache and if it is found in that then that information is retrieved.

5. If not, then the query is passed to next domain server i.e., TLD (Top Level Domain) which reviews the request and direct the query to name servers associated with that specific domain.

6. Until the query is solved it is passed to next level domains. At last the mapping and the record are returned to the resolver who checks whether the returned value is a record or an error.

7. Then the resolver returns the record back to the computer browser which is then viewed by the user.

Samacheer Kalvi 12th Computer Applications Solutions DNS (Domain Name System) Additional Question and Answer

I. Choose the Best Answer

Question 1.
Expand DNS?
(a) Direct Name Server
(b) Domain Name System
(c) Domain Name Security
(d) Direct Name Service
Answer:
(b) Domain Name System

Question 2.
Which of the following statements are true?
(i) Internet is based on IP address, not domain names.
(ii) Internet is based on domain names not on IP names.
(iii) It is easy to use domain names.
(a) (i) (iii)
(b) (i) (ii)
(c) (ii)
(d) (iii) (ii)
Answer:
(a) (i) (iii)

Question 3.
While typing a web address, DNS trAnswer:lates it into a machine friendly IP address.
(a) True
(b) False
Answer:
(a) True

Question 4.
Who invented DNS?
(i) Jon Postel
(ii) Jerold 3
(iii) V. Mockapetris
(iv) Bob Frton
(a) (i) and (ii)
(b) (ii) and (iv)
(c) (i) and (iii)
(d) (ii) and (iv)
Answer:
(c) (i) and (iii)

Question 5.
……………………….. was known as “God of the Internet” .
Answer:
Jan Postel

Question 6.
IP stands for
(a) Input process
(b) Input
(c) Internet Protocol
(d) Internet Power
Answer:
(c) Internet Protocol

Question 7.
…………………………. address is the logical address in the Network Layer
Answer:
Internet Protocol

Question 8.
How many IP addressing methods are there?
(a) 1
(b) 2
(c) 3
(d) 4
Answer:
(b) 2

Question 9.
How many ways of IPV4 address represenations are there
(a) 1
(b) 2
(c) 3
(d) 4
Answer:
(b) 2

Question 10.
In ………………………… notation, the address is written in decimal format separated by dots.
Answer:
dotted-decimal

Question 11.
What is the equivalent binary valu eof 143?
Answer:
(a) 100000
(b) 10001001
(c) 10010000
(d) 10001111
Answer:
(d) 10001111

Question 12.
IPV4 address is a ……………………….. bit unique address given to a computer
(a) 8
(b) 16
(c) 32
(d) 64
Answer:
(c) 32

Question 13.
If the protocol uses ‘n’ bits then the address space of that protocol would be …………………….
(a) n
(b) n2
(c) 2n
(d) 2ⁿ
Answer:
(d) 2ⁿ

Question 14.
The two wyas to represent the IPV4 address are ………………………… and ………………………… notations.
Answer:
Binary, Dotted-Decimal

Question 15.
The number of address that can be formed in IPV6 is
(a) 128
(b) 32
(c) 2³²
(d) 2¹²⁸
Answer:
(d) 2¹²⁸

Question 16.
In IPV6 address, the 128 bits are divided into …………………………….. 16-bits blocks.
(a) 8
(b) 4
(c) 2
(d) 1
Answer:
(a) 8

Question 17.
Each blocks in IPV6 address is changed into ………………………… Hexadecimal numbers.
(a) 8 digits
(b) 4 digit
(c) 2 digit
(d) 1 digit
Answer:
(b) 4 digit

Question 18.
Which number representations are used in IPV6 addressing?
(a) Binary
(b) decimal
(c) octal
(d) Hexadecimal
Answer:
(d) Hexadecimal

Question 19.
In IPV6 Addressing, hexadecimal numbers are separated by ……………………………
(a) :
(b) •
(c) ,
(d) ;
Answer:
(a) :

Question 20.
Which is the address of a document on the Internet?
(a) IPV4
(b) IPV6
(c) IP
(d) URL
Answer:
(d) URL

Question 21.
How many parts are there in the URL?
(a) 4
(b) 5
(c) 6
(d) 1
Answer:
(a) 4

Question 22.
How many types of URL’s are there?
(a) 1
(b) 2
(c) 3
(d) 4
Answer:
(b) 2

Question 23.
Pick the odd one out.
(a) protocols
(b) hostname
(c) server
(d) Folders
Answer:
(c) server

Question 24.
Match the following.
(i) Absolute URL – 1. Dotted Decimal notation
(ii) Relative URL – 2. Partial Address
(iii) IPV4 – 3. HexaDecimal Notation
(iv) IPV6 – 4. Complete address
(a) (i)-1 (ii)-2 (iii)-3 (iv)-4
(b) (i)-4 (ii)-2 (iii)-1 (iv)-3
(c) (i)-4 (ii)-3 (iii)-2 (iv)-1
(d) (i)-4 (ii)-1 (iii)-2 (iv)-3
Answer:
(b) (i)-4 (ii)-2 (iii)-1 (iv)-3

Question 25.
Depending on the location of the document, the URL is divided into ………………………… and ………………………. URL
Answer:
Absloute and Relative

Question 26.
Find the wrong statement from the following.
(I) Relative URL is used when the file is on the different server.
(II) Relative URL is needed when the file is on the same server.
Answer:
(I) Relative URL is used when the file is on the different server.

Question 27.
How many important components are there in the Domain Name System?
(a) 2
(b) 3
(c) 4
(d) 5
Answer:
(b) 3

Question 28.
Pick the odd one out.
(a) Relative URL
(b) Namespace
(c) Name Server
(d) Zone
Answer:
(a) Relative URL

Question 29.
There are …………………………. ways of arranging the name space?
(a) 1
(b) 2
(c) 3
(d) 4
Answer:
(b) 2

Question 30.
Identify the statements which are true.
(I) Flat name space is the name assigned to the IP address.
(II) They have a specific structure.
(III) They can be used in large systems.
(IV) They need to be accessed and controlled centrally
(a) I. IV
(b) I, II, III
(c) II, III, IV
(d) III, IV
Answer:
(a) I. IV

Question 31.
Find the wrongly matched pair about Hierarchical name spaces.
(a) First part – Nature of organization
(b) IInd part – Name or organization
(c) IIIrd part – Department or organization
(d) IVth part – Location of organization
Answer:
(d) IVth part – Location of organization

Question 32.
In hierarchical name space, names are represented with …………………………… structure.
(a) honey comb
(b) tree
(c) root
(d) hair like
Answer:
(b) tree

Question 33.
Which is present on the top in tree like structure hierarchical name space?
(a) root
(b) top
(c) tree
(d) name
Answer:
(a) root

Question 34.
In hierarchical name space, level 0 is …………………………..
(a) root
(b) top
(c) tree
(d) bottom
Answer:
(a) root

Question 35.
A tree can have a maximum of ………………………….. levels.
(a) 64
(b) 128
(c) 256
(d) 612
Answer:
(b) 128

Question 36.
A tree with 128 levels starting from root element taking the level …………………………. to ………………………………
(a) 1 to 128
(b) 0 to 128
(c) 1 to 127
(d) 0 to 127
Answer:
(d) 0 to 127

Question 37.
Find the wrong statement from the following
(a) The root element always represents the pointer
(b) The root element always represents the NULL string
(c) The root element always represents the empty string.
Answer:
(a) The root element always represents the pointer

Question 38.
The …………………………… level to the root element is the children node of root element.
(a) 0
(b) 1
(c) next
(d) previous
Answer:
(c) next

Question 39.
Each node in the tree has a ……………………………. and a ……………………….
Answer:
label, domian name

Question 40.
…………………………. are the names given to domains.
Answer:
Labels

Question 41.
Which is a subtree in domain name space tree structure?
(a) Domain
(b) root domain
(c) co-domain
(d) sub-domain
Answer:
(a) Domain

Question 42.
The domain can be further divided into ………………………..
(a) domain root
(b) root domain
(c) subdomain
(d) co-domain
Answer:
(c) subdomain

Question 43.
The domain name is always read from ………………………….. level to ………………………….. level.
(a) lower to higher
(b) higher to lower
(c) center to end
(d) beginning to center
Answer:
(a) lower to higher

Question 44.
Which one of the following is not allowed while giving domain names?
(a) alphabets
(b) digits
(c) spaces
(d) Hyphens
Answer:
(c) spaces

Question 45.
Length of the domain names is from ………………………… to ………………………. characters.
(a) 1 to 64
(b) 1 to 63
(c) 2 to 64
(d) 2 to 63
Answer:
(d) 2 to 63

Question 46.
The entire Domain name may be at most of …………………………….. characters long.
(a) 63
(b) 64
(c) 254
(d) 253
Answer:
(d) 253

Question 47.
Find the true statement from the following.
(a) Domain names are case – sensitive.
(b) Hyphen can be used as first characters of a domain name.
(c) Special symbols are not permitted in Domain names
(d) spaces are allowed
Answer:
(c) Special symbols are not permitted in Domain names

Question 48.
………………………… is the last part of a domain name.
Answer:
Top level domain

Question 49.
Generic top level domains are maintained by
(a) IANA
(b) ICWA
(c) WHOIS
(d) WHO
Answer:
(a) IANA

Question 50.
Which is the domain name for Non profit organization?
(a) NGO
(b) NPO
(c) NONORG
(d) ORG
Answer:
(d) ORG

Question 51.
…………………….. is the domain name for information service providers.
(a) isp
(b) inf
(c) info
(d) insepr
Answer:
(c) info

Question 52.
How many characters are used for country domain names?
(a) 1
(b) 2
(c) 3
(d) 4
Answer:
(b) 2

Question 53.
Match the following country domain names
(i) Srilanka – 1. cn
(ii) China – 2. Ik
(iii) Canada – 3. sg
(iv) Singapore – 4. ca
(a) (i)-2 (ii)-1 (iii)-4 (iv)-3
(b) (i)-1 (ii)-2 (iii)-3 (iv)-4
(c) (i)-4 (ii)-3 (iii)-2 (iv)-1
(d) (i)-4 (ii)-l (iii)-2 (iv)-3
Answer:
(a) (i)-2 (ii)-1 (iii)-4 (iv)-3

Question 54.
…………………………. is the domain name for Bangladesh
(a) Bd
(b) Ba
(c) Bg
(d) Bn
Answer:
(a) Bd

Question 55.
………………………….. is the country domain name for srilanka
(a) si
(b) lk
(c) sr
(d) sk
Answer:
(b) lk

Question 56.
Which language is also used in three country top level Domain names?
(a) English
(b) Urdu
(c) Tamil
(d) Hindi
Answer:
(c) Tamil

Question 57.
Pick the odd one out
(Countries using Tamil Language in Domain Names)
(a) India
(b) Singapore
(c) Bangladesh
(d) Srilanka
Answer:
(c) Bangladesh

Question 58.
Which programs runs on a physical system stores all the zone data?
(a) Name Servers
(b) Clients
(c) DNSO
(d) IP address
Answer:
(a) Name Servers

Question 59.
Which converts the IP address to domain name?
(a) Domain
(b) Name server
(c) Inverse domain
(d) Server
Answer:
(c) Inverse domain

Question 60.
Which is a main part of the DNS?
(a) Domain
(b) Name Server
(c) Subdomain
(d) Label
Answer:
(b) Name Server

Question 61.
Which one of the following is not a function of Name servers?
(a) It trAnswer:late the domain names to IP addresses
(b) It searches the domain names.
(c) It returns IP address
(d) It does not store Zone data
Answer:
(d) It does not store Zone data

Question 62.
Pick the odd one out.
(a) Root name Server
(b) Client Server
(c) Primary name Server
(d) Slave Name Server
Answer:
(b) Client Server

Question 63.
Master Name Server is otherwise called as ………………………….
Answer:
Primary Name Server

Question 64.
Match the following
(i) Root Name Server – 1. copy of primary server files
(ii) Master Name Server – 2. Zone resource records
(iii) Slave Name Server – 3. Zone file
(iv) Zone – 4. top level server
(a) (i)-1 (ii)-2 (iii)-3 (iv)-4
(b) (i)-4 (ii)-3 (iii)-2 (iv)-1
(c) (i)-1 (ii)-4 (iii)-3 (iv)-2
(d) (i)-4 (ii)-2 (iii)-1 (iv)-3
Answer:
(d) (i)-4 (ii)-2 (iii)-1 (iv)-3

Question 65.
How many Root Name Servers are there?
(a) 10
(b) 13
(c) 20
(d) 23
Answer:
(b) 13

Question 66.
………………………….. server has entire DNS tree.
(a) Root Name
(b) Primary
(c) Master Name
(d) Slave Name
Answer:
(a) Root Name

Question 67.
Find the correct statement
(I) Slave Name Server contains copy of primary server files
(II) Slave Name has authority to update.
(a) I-True, II-False
(b) I-False, II-True
(c) I, II – Both True
(d) I, II – Both False
Answer:
(a) I-True, II-False

Question 68.
What is the another name for Slave Name Server?
(a) Root
(b) Primary
(c) Master
(d) Secondary
Answer:
(d) Secondary

Question 69.
Which Name Server can update the records?
(a) Root
(b) Primary
(c) Secondary
(d) Slave
Answer:
(b) Primary

Question 70.
ICANN stands for ………………………….
Answer:
Internet Corporation for Assigned Name and Numbers

Question 71.
How many copies of zone files are there?
(a) 2
(b) 3
(c) 4
(d) 5
Answer:
(a) 2

Question 72.
The two copies of zone files are ………………………… and ……………………….
Answer:
Master file, Slave file

Question 73.
Every Zone has the server which contains a database called
(a) Zone file
(b) Master Name Server
(c) Slave Name Server
(d) Root file
Answer:
(a) Zone file

Question 74.
Find the wrong statement.
(I) protocol is needed to form a connection between the resolver and the user program
(II) protocol is not necessary to form a connection between the resolver and the user program
Answer:
(I) protocol is needed to form a connection between the resolver and the user program

Question 75.
While typing the URL in browser, the browser send the URL to …………………………..
(a) DNS
(b) DMS
(c) ICANN
(d) WHOIS
Answer:
(a) DNS

Question 76.
server is used to host the websites and to deliver the contents of websites using
(a) DNS
(b) HTTP
(c) WWW
(d) ISP
Answer:
(b) HTTP

Question 77.
……………………….. directs the query to name servers associated with that specific domain.
(a) TLD
(b) DNS
(c) ICANN
(d) ISP
Answer:
(a) TLD

Question 78.
IANA stands for ………………………..
Answer:
Internet Assigned Numbers Authority

Question 79.
The registered domain names and their Answer:wers are available in
(a) ICT
(b) WHOIS
(c) IANA
(d) WHO WAS
Answer:
(b) WHOIS

Question 80.
Which of the following are managed by IANA?
(a) DNS Root
(b) IP Addressing
(c) Internet protocol resource handling
(d) All of these
Answer:
(d) All of these

Question 81.
……………………………. URL contains all the four necessary and fundamental parts of URL.
Answer:
Absolute

II. Short Answer

Question 1.
Name the four parts of URL?
Answer:
URL is made up four parts-protocols, hostname, folder name and file name. Each part has its own specific functions. Depending on the applications, additional information can be added to the URL but the common and fundamental URL consists of these four parts.

Question 2.
How are the name spaces organized?
Answer:
The name space can be organized in two ways

1. Flat name space
2. Hierarchical name space

Question 3.
What is the use of Generic Top-level Domain names?
Answer:
Give Example.
Generic Top-Level Domain names:
Top level domain is the last part of a domain name. Generic top level domains are used for generic purpose and maintained by IANA.
Generic Domian Names:

Question 4.
Define Country top-leve domain names?
Country top-level domain names
Answer:
Country domain uses 2-character country abbreviation according to country. For e.g., google, in – for INDIA, google.us for US.
Country domain names:

Question 5.
What is Inverse domain?
Answer:
Inverse domain performs the opposite task of normal DNS query. It converts the IP address to domain name.

Question 6.
What is WHOIS?
Answer:
The WHOIS is a service of ICANN. It is a free, publicly available directory containing the details of registered domain names and their owners (registrants), https://whois.icann.org/en

Question 7.
Write the demerits of Flat name space?
Answer:
The major disadvantage of flat name space is that they cannot be used in large system. Because they need to be accessed and controlled centrally to avoid ambiguity and redundancy.

III. Explain in Brief Answer

Question 1.
What are the two ways to represent IPV4 address? Explain with examples?
Answer:
There are two ways to represent the IP address:

1. Binary notation
2. Dotted-decimal notation

In binary notation the address is expressed as 32-bit binary values.
For E.g. 00111001 10001001 00111000 00000111

In dotted-decimal notation the address is written in decimal format separated by dots(.).
For e.g. 128.143.137.144

Question 2.
What is meant by Label?
Answer:
Label:
It is a string which can have maximum of 63 characters. Each node in that level should have different labels thereby assuring the individuality of the domain name. In other words, Labels are the names given to domains. Domain is a sub tree in domain name space tree structure. The domain can be further divided into sub domains.

Question 3.
List any six country domain names?
Answer:
Domain Name – Meaning
in – India
us – United States
fr – France
uk – United Kingdom
ca – Canada
au – Australia

Question 4.
Explain the types of Name servers?
Answer:
Types of Name Servers:
There are three types of Name Servers which control the entire Domain Name System:
Root Name Server – top level server which contains entire DNS tree, maintained by ICANN. There are 13 servers.

Primary/Master Name Server- contains a zone resource records. These records are updatable by domain name holders such as organizations.

Secondary/Slave Name Server – contains a copy of primary server files. This server has no authority to update, but reduce the workload of master server by sharing the queries.

Question 5.
Write note on ICANN?
Answer:
ICANN, Internet Corporation for Assigned Name and Numbers is the Non-profit Organization which assigns names and numbers for all Internet resources like domain names and IP addresses.

Question 6.
What is IANA?
Answer:
IANA is an affiliated authority of ICANN. IANA does the overall management of the DNS Root, IP addressing, and other Internet protocol resource handling. IANA takes care of a number of key aspects of the DNS, including the root zone, and the domains .int and .arpa. https://www.iana.org/

IV. Explain in detail

Question 1.
Explain URL?
Answer:
Uniform Resource Locator (URL):
URL (Uniform Resource Locator) is the address of a document on the Internet. URL is made up four parts-protocols, hostname, folder name and file name. Each part has its own specific functions. Depending on the applications, additional information can be added to the URL but the common and fundamental URL consists of these four parts.

The basic URL where http is a protocol, www.cms.tn.gov.in is a hostname / domain name, sites/default/files/press release are the folders and pr070119a.jpg is the file name. These are all the basic information which can be obtained from a URL.

URL Type:
Depending on the location of the document the URL is divided into 2 types

1. Absolute URL
2. Relative URL

Absolute URL:
Absolute URL is the complete address of a document on the Internet. Absolute URL contains all the information that are required to find the files on the Internet. These are similar to postal address if any of the information is missing then the post will not be able to deliver to the right person. Similarly, if any of the four parts is missing then the browser would not able to link to the specific file. So, all the four parts is very important in absolute URL.

Relative URL:
Relative URL is the partial address of a document on the Internet. Relative URL contains only file name or file name with folder name. We can use this type of URL when the file is on the same server related to original document.

Question 2.
Explain the Basic rules of Domain names?
Answer:
Basic rules of Domain names:

1. Domain can consists of Alphabets a through z, and the digits 0 through 9.
2. Hyphens are allowed, but hyphens can not be used as first character of a domain name.
3. Spaces are not allowed
4. Special symbols (such as !,$,&, _ and so on) are not permitted, length of 2, and the maximum length of 63 characters.
5. The entire name may be at most 253 characters long.
6. Domain names are not case-sensitive.(It may be upper, lower or mixing of both case letters)

Students can Download Computer Applications Chapter 10 Introduction to Computer Networks Questions and Answers, Notes Pdf, Samacheer Kalvi 12th Computer Applications Book Solutions Guide Pdf helps you to revise the complete Tamilnadu State Board New Syllabus and score more marks in your examinations.

Tamilnadu Samacheer Kalvi 12th Computer Applications Solutions Chapter 10 Introduction to Computer Networks

Samacheer Kalvi 12th Computer Applications Introduction to Computer Networks Text Book Back Questions and Answers

PART – I
I. Choose The Correct Answer

Question 1.
A set of computers connecting together is called as …………………………
(a) Network
(b) Server
(c) Hub
(d) Node
Answer:
(a) Network

Question 2.
Computer network devices that originates route and terminate the data were called as ………………………………
(a) Hub
(b) Resource
(c) Node
(d) Cable
Answer:
(c) Node

Question 3.
Match the period and methods available on history of computer networking in the Internet
1.1950 – (a) X.25 TCP/IP
2. 1966 – (b) SAGE
3. 1976 – (c) WAN
4. 1972 – (d) ARCNET
(a) 1 -(d) 2-(c) 3-(b) 4-(d)
(b) 1 -(c) 2-(d) 3-(b) A-(a)
(c) 1-(a) 2-(b) 3-(c) 4-(d)
(d) 1-(b) 2-(c) 3-(d) 4-(a)
Answer:
(d) 1-(b) 2-(c) 3-(d) 4-(a)

Question 4.
Western Electric introduced the first widely used …………………………… that implemented true computer control.
(a) Packet switch
(b) Arpanet
(c) Host
(d) Telephone switch
Answer:
(d) Telephone switch

Question 5.
Wi-Fi is short name for ………………………………
(a) Wireless Fidelity
(b) Wired fidelity
(c) Wired fiber optic
(d) Wireless fiber optic
Answer:
(a) Wireless Fidelity

Question 6.
People everywhere can express and publish their ideas and opinions via …………………………
(a) Tele-medicine
(b) blogging
(c) Server
(d) Node
Answer:
(b) blogging

Question 7.
Which one of the following periods, the speed capacity supported towards gigabit on computer network?
(a) SABRE
(b) SAGE
(c) NEW FIBRE OPTICS
(d) ARCNET
Answer:
(c) NEW FIBRE OPTICS

Question 8.
One among them was challenging to the business people on computer networking
(a) Hacking
(b) Viruses
(c) Both a & b
(d) none of the above
Answer:
(c) Both a & b

Question 9.
………………………….. able to predict, manage, and protect the computer network at Internet.
(a) Artificial intelligence
(b) Broadband provider
(c) Cloud computing
(d) TrAnswer:ceivers
Answer:
(a) Artificial intelligence

Question 10.
…………………………… use less power comparing with single trAnswer:mitter or satellite often cell towers nearer.
(a) Mobile devices
(b) TrAnswer:istors
(c) WIFI
(d) Communication
Answer:
(a) Mobile devices

Question 11.
People now a days getting relaxed via ……………………………..
(a) Business
(b) Corporate company
(c) News papers
(d) Social media
Answer:
(d) Social media

Question 12.
Which one of the following is not the social media
(a) Gmail
(b) Facebook
(c) twitter
(d) Linkedin
Answer:
(a) Gmail

Question 13.
Facebook was created at ………………………….. year
(a) 2002
(b) 2004
(c) 2013
(d) 2010
Answer:
(b) 2004

Question 14.
In mobile network, land areas for network coverage was distributed as ……………………………….
(a) Firmware
(b) cells
(c) Range
(d) Service
Answer:
(b) cells

Question 15.
Which one were harmful to computer?
(a) Bloggers
(b) Browser
(c) Hackers
(d) twitter
Answer:
(c) Hackers

Question 16.
Which innovation made the people to use Internet?
(a) Social web
(b) Mobile technology
(c) Mobile App
(d) Both a & b
Answer:
(d) Both a & b

PART – II
II. Short Answer

Question 1.
Define Computer Network?
Answer:

1. A set of computers connected together for the purpose of sharing resources is called as computer networks.
2. At present, Internet is the most common resource shared everywhere.

Question 2.
Define Internet?
Answer:

1. Networks of network is called Internet.
2. Now a days the Internet plays a vital role.
3. It provides all the information and services to us.

Question 3.
What are the common uses of computer network?
Answer:
The common uses of computer network are

1. Communication
2. Resource sharing
3. Data (or) software sharing
4. Money saving

Question 4.
List out some features of mobile network?
Answer:
Features of Mobile Networks:
1. Less consumption of power is used by mobile devices comparing with a single mitter or satellite often cell towers were nearer.

2. Huge capacity than a large mitter, at single frequency can be used for different or many links as long as they are in different in cells.

3. Covering large area than a single mitter, we can add more towers indefinitely and cannot be limited by any horizon limits.

Question 5.
Difference between wired and wireless networks?
Answer:
Networks at home were connected in two ways they are:

1. Wired network
2. Wireless network

A Wired network system connected with network cable. For example speakers, CCTV, printers, outdoors, and scanners etc., with cables.
A Wireless network is connecting devices like tablets(tab), indoor cameras and E-readers, etc., without cables (WiFi).

PART – III
III. Explain in Brief Answer

Question 1.
Define ARPANET?
Answer:
First In 1969, four nodes of ARPANET were connected between four universities namely the university of California at Los Angeles, at Santa Barbara, the Stanford Research Institute and the university of Utah using the 50 Kbit/s circuits.

Packet -switched networks was the theoretical work to model was performed by Leonard Kl’einrock, ARPANET was which underpinned the development of it and his theoretical work on hierarchical routing in late 1970 s with his student Farouk Kamoun remains critical to the operation of the Internet today.

Question 2.
What is the usage of cloud storage and cloud computing?
Answer:
Cloud Storage:
Cloud Storage is without any Just a storage of data on online. It can be access from different area geographical limits

Cloud Computing:
Cloud Computing is based on Internet computing, to share resources, software and information.

Question 3.
What is meant by artificial Intelligence?
Answer:

1. Artificial intelligence able to be a better predict traffic as it collects and analyzes data in real time,
2. some of network managers were better prepared for big events such as the World cup, Olympics, Valentine’s Day, which often put on the Internet under pressure.
3. Now the networks were monitored by algorithm that enables for anomalous build-ups of traffic and activity which may be the result of nasty activities such as (DDos) Distributed Denial-of-Service attacks and attempted hacks.
4. This Artificial Network powering algorithms will become most intelligent; it might find faster and reliable methods of anticipating threats and cleaning networks.

Question 4.
List out some usefulness of social networks?
Answer:
Social networking lead us some extremely useful benefits to their individuals and communities:

(i) Group information sharing over long distances:
1. Although friends and family members can keep in contact via mobile phone calls or by text messages, social nets suggestion a much richer environment for staying connected. To many scenarios such as sharing photo albums videos or convey their wishes someone, work better these networks because an entire group can participate together with one.

2. Group discussions became more convenient.

(ii) Broadcast announcements:

1. Cities can more comfort to spread word of emergencies and natural calamities.
2. Venues and local shops can advertise upcoming events on social networks.
3. Businesses able market their products to customers (and retrieve some direct feedback).

(iii) Fostering diversity of thought.:
1. Some critics of social networks point out that online communities attract people by similar interests and backgrounds.

2. when the people with different opinions do get together on online, many discussions seem to degenerate into personal attacks and so-called “flame wars.” It can be argued, by online debates
are healthy in the long run.

Question 5.
How computer networks saves the money saving?
Answer:
Money saving:
Using the computer networking, it’s important financial aspect for organization because it saves money. It reduces the paper work, man power and save the time.

PART – IV
IV. Explain in detail

Question 1.
Define computer networking and Internet. Explain different developments on computer network and Internet?
Answer:
History of Computer Networking and the Internet:
The history of computer networks and its development were briefly explained in the table given below:
A set of computers connected together for the purpose of sharing resources is called as computer networks. At present, Internet is the most common resource shared everywhere. Some of the shared resources are file server, web camera, speakers, printer, scanner, fax machine etc., Accessing services such as WWW (World Wide Web), Digital audio, Digital video which are shared t use applications, software, and storage servers. All are well-known the term Internet Networks of network is called Internet.

Question 2.
Explain the growth of the computer networking?
Answer:
Now a days computer network technology was developing in very interesting ways. Some keys developed that have occurred over past several years included.
1. Growth on popularity of cloud storage and cloud computing. On behalf of buying physical copies of games, music and movies, increasingly downloading (or streaming) and buy digital licenses their need via Internet.

2. Developments on mobile network infrastructurerboth deployments of 4G and 3G networks (older) that have allow the people in their developed areas who can allow it to their smart mobile phones as video broadcasting system and as mobile television. Some of the people underlying and staying connected all the times, whenever they at the workplace, via a home network, via public WiFi hotspots or smart phones.

3. Difficulties faced by the service providers (include Google)in expanding their residential fiber optic cables Internet service due to increased competition and installation cost from other broadband providers.

4. Even though 4G LTE mobile network was not reached by many parts of world, the industry of telecommunication has been hard working on the development of their next generation “5G” cellular communication Technology.

5. This 5G intense to boost up the speed the mobile connections dramatically. Exactly how much customers was in need of this 5G connection and to go.

6. When 4G was initially being developed, companies are not waited and they do not feel shy to advertisement about the 5G efforts.

7. It might be tested on laboratory on by prototype versions of some elements then it may be standard 5G consumers were also interested on the promise of signal coverage with 5G.,

1. Artificial intelligence will help to maintain, manage, and protect it. Now the networks were monitored by algorithm that enables for anomalous build-ups of traffic and activity which may be the result of nasty activities such as (DDos) Distributed Denial-of-Service attacks and attempted hacks.

2. This Artificial Network powering algorithms will become most intelligent; it might find faster and reliable methods of anticipating threats and cleaning networks.

3. Artificial intelligence able to be a better predict traffic as it collects and analyzes data in real time, some of network managers were better prepared for big events such as the World cup , Olympics, Valentine’s Day, which often put on the Internet under pressure.

Question 3.
Mention some uses of network at business, home, mobile, social application?
Answer:
(i) Networks in Business:
1. In twenty first centuries communications is necessary for successful business operations and technology for the business interaction.

2. Computer networks were faster, the Internet became full strength and wireless communications has been formed the way of business performed.

3. By the usage of latest technologies, such as cloud computing, are being used to allow globally without scarifying security or limiting user access.

4. Internet conversations happen faster, Quick Decision making saves a lot of time, we all know that “time is money” in business.

5. Through e-banking we can pay or receive money from or to the customer may be easily done via gateways or by online payments were much easier on this method. Here any type of business it might large or small scale B2C, B2B, B2G,C2B, C2C, C2G, G2B,G2C, G2G or commercial that trAnswer:fer of information across the Internet can be done here.

(ii) Networks at Home:
Network at home is a group of devices such as computers, mobile, speakers, camera, game system, and printer that connect via network with each other. Networks at home were connected in two ways they are

1. Wired network
2. Wireless network

A Wired network system connected with network cable . For example speakers, CCTV, printers, outdoors, and scanners etc., with cables.
A Wireless network is connecting devices like tablets(.tab), indoor cameras and E-readers, etc., without cables (WiFi).
Network at home plays main role to access all such as e-banking, e-leaming, e-govemance, – e-health, telemedicine, call centers, video conferencing, digitalization of memories, can easy to access and use by avoiding lot of time and stacked at queue.
From the home we ordered delicious food from various hotels and restaurants at time without delay can be bought via Internet.

(iii) Mobile Networks:
Mobile network is the network connecting devices without cable (wireless). Mobile computers, such as laptop, tablet, and hand held computers, were fastest growing segments.

(iv) Social Application:
Very fast and easiest way to cover all the people, who they are connected in social network media. For example WhatsApp, Face book, twitter, blogs, pintrest, Linkedln, classmates and so on. Through the above social media we share our thoughts in different formats and different size of files.

Samacheer Kalvi 12th Computer Applications Solutions Introduction to Computer Networks Additional Question and Answer

I. Choose the Best Answer

Question 1.
www means ………………………………
Answer:
world wide web

Question 2.
Which one of the following resources cannot be shared?
(a) printer
(b) scanner
(c) speakers
(d) monitor
Answer:
(d) monitor

Question 3.
Network of Network is called ………………………….
(a) Internet
(b) Intranet
(c) Extranet
(d) Local net
Answer:
(a) Internet

Question 4.
The computers which are connected to network are called as …………………………
(a) computer
(b) nodes
(c) Intemodes
(d) CPU
Answer:
(b) nodes

Question 5.
In networking, nodes are identified by its …………………………….
(a) Protocol
(b) Layer
(c) IP address
(d) TCL address
Answer:
(c) IP address

Question 6.
Who co-designed TCP/IP protocols?
(a) Vint cerf
(b) Bill gates
(c) Lawrence
(d) Roberts
Answer:
(a) Vint cerf

Question 7.
Who is the founding father of Internet?
(a) Vint cerf
(b) Bob Frankston
(c) Danbricklin
(d) Laerence Robert
Answer:
(a) Vint cerf

Question 8.
Expand SAGE
(a) Semi-Automatic Ground Environment
(b) Self – Auto General Engine
(c) Super – Automatic General Engine
(d) Super – Auto Ground Environment
Answer:
(a) Semi-Automatic Ground Environment

Question 9.
Expand SABRE
(a) Self Automated Base Relational Entity
(b) Semi Automatic Business Research Environment
(c) Super Automatic BIOS Return Entity
(d) Star Automated Base Router Entity
Answer:
(b) Semi Automatic Business Research Environment

Question 10.
In which year SABRE was developed?
(a) 1958
(b) 1950
(c) 1960
(d) 1968
Answer:
(c) 1960\

Question 11.
Find the wrongly matched pair from the following.
(a) SAGE – V. S. Military Radar System
(b) SABRE – Airline Reservation System
(c) Hosts – Cyclades
(d) Arpanet – Token – passing Network
Answer:
(d) Arpanet – Token – passing Network

Question 12.
Paul Baran developed …………………………
(a) Packet Switching
(b) SAGE
(c) SABRE
(d) node
Answer:
(a) Packet Switching

Question 13.
NPL stands for ……………………………
Answer:
National Physical Laboratory

Question 14.
What is the line speed of NPL network?
(a) 268 kb/s
(b) 768 kb/s
(c) 678 kb/s
(d) 578 kb/s
Answer:
(b) 768 kb/s

Question 15.
Identify the correctly matched pair from the following.
(i) 1963 – Intergalactic Computer Network
(ii) 1996 – New Fibre Optic Cables
(iii) 1974 – Hosts
(iv) 1967 -WAN
(a) (ii)
(b) (iii)
(c) (iv)
(d) (i)
Answer:
(d) (i)

Question 16.
Intergalactic computer Network was developed in the year ………………………….
(a) 1950
(b) 1960
(c) 1963
(d) 1967
Answer:
(c) 1963

Question 17.
An experimental paper on WAN has been published by ………………………………..
(a) Thomas Marill
(b) Robert
(c) Lawrence
(d) Abramson
Answer:
(a) Thomas Marill vb

Question 18.
……………………….. was the first french networm for making host, for reliable data delivery.
(a) ARPANET
(b) CYCLADES
(c) ARCNET
(d) WAN
Answer:
(b) CYCLADES

Question 19.
Ethernet is a ………………………. based networking System.
Answer:
Aloha

Question 20.
A memo at Xerox PARC was written by ……………………………..
Answer:
Robert Metcalfe

Question 21.
Who created ARCNET?
(a) Leonard Kleinrock
(b) Cyclades
(c) Robert Metcalfe
(d) John Murphy
Answer:
(d) John Murphy

Question 22.
Match the following
(i) Ethernet – (I) Ieonard Kleinrock
(ii) Arcnet – (II) Robert Metcalfe
(iii) WAN – (III) John Murphy
(iv) Packet-Switched Network – (IV) Thomas Manu
(a) II III IV I
(b) I II III IV
(c) IV II I III
(d) IV I II III
Answer:
(a) II III IV I

Question 23.
Find which is wrong.
INTERNET stands for
(a) INTERnational NETwork
(b) INTER connected Computer NETwork
(c) Intersecting Notions TrAnswer:mitted Electronically Round Newly Engineered
(d) All are correct
Answer:
(d) All are correct

Question 24.
Pick the odd one out.
(a) Flipkart
(b) Gmail
(c) Amazon
(d) Snap deal
Answer:
(b) Gmail

Question 25.
………………………… is used to collect the certificates online.
(a) e-leaming
(b) e-governance
(c) e-certificates
(d) e-degree
Answer:
(b) e-governance

Question 26.
How many million active users are there in Facebook?
(a) 1230
(b) 2320
(c) 2230
(d) 3220
Answer:
(c) 2230

Question 27.
DDos means …………………………….
Answer:
Distributed Denial-of-service

Question 28.
……………………….. me one device accessed by many systems.
Answer:
Resource sharing

Question 29.
Pick the odd one out.
(a) B2C
(b) A2B
(c) B2B
(d) C2C
Answer:
(b) A2B

Question 30.
Because of Internet
(I) Direct human interactions are reduced
(II) Working environment is shrinked.
(a) I-True II-False
(b) I-False II-True
(c) I, II-both True
(d) I, II-both False
Answer:
(c) I, II-both True

Question 31.
Network at home can be connected in …………………………….. ways.
Answer:
2

Question 34.
Identify which is not an attribute of social network.
(a) Membership
(b) Human relationship building
(c) Frequent return visits
(d) DSL
Answer:
(d) DSL

Question 35.
When the people with different opinions get together online, then that generate personal attacks called ……………………………
(a) Flame War
(b) blue war
(c) Black war
(d) Netwar
Answer:
(a) Flame War

Question 36.
The mobile electronic device used to read digital e-book is called …………………………….
Answer:
e-Reader

Question 37.
………………………….. are malware treats or computer worms that replicates by its own.
Answer:
Viruses

II. Short Answer

Question 1.
Name the attributes of social networkings?
Answer:

1. Membership
2. Content contribution
3. Frequent return visits
4. Human relationship building

III. Explain in Brief Answer

Question 1.
What are the disadvantages of Internet?
Answer:
Disadvantages of Internet:

1. Simply wasting the precious time on Internet by surfing, searching unwanted things.
2. Lot of unnecessary information is also there, why because any one can post anything on their webpage, blogs.
3. Hackers and viruses can easily theft our more valuable information available in the Internet. There a lot of security issues are there in E-banking.

Question 2.
Write a note on E-Banking?
Answer:
E-Banking plays an important role in our day today life, via Internet it can be accessed anytime, anywhere 24/7.
The speed and efficiency was very much better than that of done by counter at bank.
Now a days online payment were done via Internet to avoid standing in the queue at office to pay bills with very low action fees.

Question 3.
Write note on Resource Sharing?
Answer:
1. ‘Resource sharing meAnswer: one device accessed by many systems.

2. It allows all kind of programs, equipment’s and available data to anyone via network to irrespective of the physical location of the resource of them.

3. Simply resource sharing is sharing such as printers, scanner, PDA, fax machine, and modems. For example, many computers can access one printer if it is in networks.

4. Write note on Software or data sharing.
Using computer network, application or other software will be stored at central computer or server. We can share one software from one to another. It provides high reliability source of the data.

For example, all files can not be taken backup or duplicate on more than one computer. So if one is not unavailable due to hardware failure or any other reason, the copies can be used.

Question 4.
Write note on Software or data sharing?
Answer:

1. Using computer network, application or other software will be stored at central computer or server.
2. We can share one software from one to another. It provides high reliability source of the data.
3. For example, all files can not be taken backup or duplicate on more than one computer.
4. So if one is not unavailable due to hardware failure or any other reason, the copies can be used.

Question 5.
Write note on e-market or online shopping?
Answer:

1. e-market or by online shopping we can get from tooth paste to car, all the travelling tickets and services can be done easier via Internet and computer networking. No geographical can separate them.
2. From the home we ordered delicious food from various hotels and restarants at time without delay can be bought via Internet.

IV. Explain in detail

Question 1.
Explain how Social Networks are useful to the Individuals and community?
Answer:
Usefulness of Social Networks:
Besides being a fun place to meet and relax with people, social networking lead us some extremely useful benefits to their individuals and communities:

1. Group information sharing over long distances:
Although friends and family members can keep in contact via mobile phone calls or by text messages, social nets suggestion a much richer environment for staying connected.

To many scenarios such as sharing photo albums videos or convey their wishes someone, work better these networks because an entire group can participate together with one. Overall, group discussions became more convenient as not everyone needs to be online at the exact same moment to post comments.

2. Broadcast announcements:

1. Cities can more comfort to spread word of emergencies and natural calamities.
2. Venues and local shops can advertise upcoming events on social networks.
3. Businesses able market their products to customers (and retrieve some direct feedback).

3. Fostering diversity of thought:

1. Some critics of social networks point out that online communities attract people by similar interests and backgrounds.
2. Indeed, when the people with different opinions do get together on online, many discussions seem to degenerate into personal attacks and so-called “flame wars.”
3. It can be argued, by online debates are healthy in the long run.
4. Although individuals may begin with more extreme views, over time their thinking gets influenced may begin with more extreme views, over time their thinking gets influenced by the comments of others at least to some extent.
5. For people who struck with busy schedule can have some relaxation and known current affairs, news via this social networks can easier to wish someone and keep on touch their follower, loveable person.

Students can Download Bio Zoology Chapter 5 Molecular Genetics Questions and Answers, Notes Pdf, Samacheer Kalvi 12th Bio Zoology Book Solutions Guide Pdf helps you to revise the complete Tamilnadu State Board New Syllabus and score more marks in your examinations.

Tamilnadu Samacheer Kalvi 12th Bio Zoology Solutions Chapter 5 Molecular Genetics

Samacheer Kalvi 12th Bio Zoology Molecular Genetics Text Book Back Questions and Answers

Question 1.
Hershey and Chase experiment with bacteriophage showed that
(a) Protein gets into the bacterial cells
(b) DNA is the genetic material
(c) DNA contains radioactive sulphur
(d) Viruses undergo transformation
Answer:
(b) DNA is the genetic material

Question 2.
DNA and RNA are similar with respect to
(a) Thymine as a nitrogen base
(b) A single-stranded helix shape
(c) Nucleotide containing sugars, nitrogen bases and phosphates
(d) The same sequence of nucleotides for the amino acid phenyl alanine
Answer:
(c) Nucleotide containing sugars, nitrogen bases and phosphates

Question 3.
A mRNA molecule is produced by
(a) Replication
(b) Transcription
(c) Duplication
(d) Translation
Answer:
(b) Transcription

Question 4.
The total number of nitrogenous bases in human genome is estimated to be about
(a) 3.5 million
(b) 35000
(c) 35 million
(d) 3.1 billion
Answer:
(d) 3.1 billion

Question 5.
E. coli cell grown on 15N medium are transferred to 14N medium and allowed to grow for two generations. DNA extracted from these cells is ultracentrifuged in a cesium chloride density gradient. What density distribution of DNA would you expect in this experiment?
(a) One high and one low density band
(b) One intermediate density band
(c) One high and one intermediate density band
(d) One low and one intermediate density band
Answer:
(d) One low and one intermediate density band

Question 6.
What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?
(a) Origin of replication occurs only at the 5’ end of the molecules
(b) DNA ligase works only in the 3’ → 5’ direction
(c) DNA polymerase can join new nucleotides only to the 3 ’ end of the growing stand
(d) Helicases and single-strand binding proteins that work at the 5’ end
Answer:
(d) Helicases and single-strand binding proteins that work at the 5’ end

Question 7.
Which of the following is the correct sequence of event with reference to the central dogma?
(a) Transcription, Translation, Replication
(b) Transcription, Replication, Translation
(c) Duplication, Translation, Transcription
(d) Replication, Transcription, Translation
Answer:
(d) Replication, Transcription, Translation

Question 8.
Which of the following statements about DNA replication is not correct?
(a) Unwinding of DNA molecule occurs as hydrogen bonds break
(b) Replication occurs as each base is paired with another exactly like it
(c) Process is known as semi – conservative replication because one old strand is conserved in the new molecule
(d) Complementary base pairs are held together with hydrogen bonds
Answer:
(b) Replication occurs as each base is paired with another exactly like it

Question 9.
Which of the following statements is not true about DNA replication in eukaryotes?
(a)) Replication begins at a single origin of replication.
(b) Replication is bidirectional from the origins.
(c) Replication occurs at about 1 million base pairs per minute.
(d) There are numerous different bacterial chromosomes, with replication occurring in each at the same time.
Answer:
(d) There are numerous different bacterial chromosomes, with replication occurring in each at the same time.

Question 10.
The first codon to be deciphered was which codes for
(a) AAA, proline
(b) GGG, alanine
(c) UUU, Phenylalanine
(d) TTT, arginine
Answer:
(c) UUU, Phenylalanine

Question 11.
Meselson and Stahl’s experiment proved __________
(a) Transduction
(b) Transformation
(c) DNA is the genetic material
(d) Semi-conservative nature of DNA replication
Answer:
(d) Semi-conservative nature of DNA replication

Question 12.
Ribosomes are composed of two subunits; the smaller subunit of a ribosome has a binding site for and the larger subunit has two binding sites for two
Answer:
mRNA, tRNA

Question 13.
Anoperonisa:
(a) Protein that suppresses gene expression
(b) Protein that accelerates gene expression
(c) Cluster of structural genes with related function
(d) Gene that switched other genes on or off
Answer:
(d) Gene that switched other genes on or off

Question 14.
When lactose is present in the culture medium:
(a) Transcription of lacy, lac z, lac a genes occurs
(b) Repressor is unable to bind to the operator
(c) Repressor is able to bind to the operator
(d) Both (a) and (b) are correct
Answer:
(d) Both (a) and (b) are correct

Question 15.
Give reasons: Genetic code is ‘universal’.
Answer:
The genetic code is universal. It means that all known living systems use nucleic acids and the same three base codons (triplet codon) direct the synthesis of protein from amino acids. . For example, the mRNA (UUU) codon codes for phenylalanine in all cells of all organisms. Some exceptions are reported in prokaryotic, mitochondrial and chloroplast genomes. However, similarities are more common than differences.

Question 16.
Name the parts marked ‘A’ and ‘B’ in the given transcription unit:
Answer:

Question 17.
Differentiate – Leading strand and lagging strand
Answer:

1. DNA polymerase I Involved DNA repair mechanism
2. DNA polymerase II Involved DNA repair mechanism
3. DNA polymerase III Involved in DNA replication

Question 18.
Differentiate – Template strand and coding strand.
Answer:
Template Strand: During replication, DNA strand having the polarity 3’ → 5’ act as template strand.

Coding Strand: During replication, DNA strand having the polarity 5’ → 3’ act as coding strand.

Question 19.
Mention any two ways in which single nucleotide polymorphism (SNPs) identified in the human genome can bring a revolutionary change in biological and medical science.
Answer:
Scientists have identified about 1.4 million locations, where single-base DNA differences (SNPs – Single nucleotide polymorphism – pronounced as ‘snips’) occur in humans. Identification of ‘SNIPS’ is helpful in finding chromosomal locations for disease-associated sequences and tracing human history.

Question 20.
State any three goals of the human genome project.
Answer:

• Identify all the genes (approximately 30000) in human DNA.
• Determine the sequence of the three billion chemical base pairs that make up the human DNA.
• To store this information in databases.

Question 21.
In E.coli, three enzymes 0- galactosidase, permease, and transacetylase are produced in the presence of lactose. Explain why the enzymes are not synthesized in the absence of lactose.
Answer:
In the absence of lactose, the repressor protein binds to the operator and prevents the transcription of the structural gene by RNA polymerase, hence the enzymes are not produced. However, there will always be a minimal level of lac operon expression even in absence of lactose.

Question 22.
Distinguish between structural gene, a regulatory gene, and operator gene.
Answer:
Structure of the operon: Each operon is a unit of gene expression and regulation and consists of one or more structural genes and an adjacent operator gene that controls the transcriptional, activity of the structural gene.

• The structural gene codes for proteins, rRNA, and tRNA required by the cell.
• Promoters are the signal sequences in DNA that initiate RNA synthesis. RNA polymerase binds to the promoter prior to the initiation of transcription.
• The operators are present between the promoters and structural genes. The repressor protein binds to the operator region of the operon.

Question 23.
A low level of expression of lac operon occurs at all the time in E-coli. Justify the statement.
Answer:
One of the enzyme synthesized by lac operon is permease which is involved in the transport of lactose into the cells. If the lac operon gets inactivated, permease is not synthesized hence lactose cannot enter the cell. Lactose acts as an inducer, binding to the repressor protein and switch on the operator to initiate gene expression.

Question 24.
Why the human genome project is called a megaproject?
Answer:
The international human genome project was launched in the year 1990. It was a mega project and took 13 years to complete. The human genome is about 25 times larger than the genome of any organism sequenced to date and is the first vertebrate genome to be completed. Human genome is said to have approximately 3 x 109 bp. HGP was closely associated with the rapid development of a new area in biology called bioinformatics.

Question 25.
From their examination of the structure of DNA, What did Watson and Crick infer about the probable mechanism of DNA replication, coding capability and mutation?
Answer:
Inference of Watson and Crick on DNA replication: They concluded that each of the DNA strand in a helix act as template during DNA replication leading to formation of new daughter DNA molecules, which are complementary to parental strand, (i.e., Semi-conservative method of replication) Inference on coding capability: During transcription, the genetic information in the DNA strand is coded to mRNA as complementary bases, (except for uracil in place of thymine in RNA) Inference on mutation: Any changes in the nucleotide sequence of DNA leads to the corresponding alteration in amino acid sequence of specific protein thus confirming the validity of genetic code.

Question 26.
Why tRNA is called an adapter molecule?
Answer:
The transfer RNA, (tRNA) molecule of a cell acts as a vehicle that picks up the amino acids scattered through the cytoplasm and also reads specific codes of mRNA molecules. Hence it is called an adapter molecule. This term was postulated by Francis Crick.

Question 27.
What are the three structural differences between RNA and DNA?
Answer:
DNA:

1. Sugar is deoxyribose sugar.
2. Double-stranded structure.
3. Nitrogen bases are Adenine, Guanine, Cytosine and Thymine.

RNA:

1. Sugar is ribose sugar.
2. Single-stranded molecule.
3. Nitrogen bases are Adenine, Guanine, Cytosine and Uracil.

Question 28.
Name the anticodon required to recognize the following codons:
AAU, CGA, UAU, and GCA.
Answer:
UUA, GCU, AUA and CGU.

Question 29.
(a) Identify the figure given below
(b) Redraw the structure as a replicating fork and label the parts
(c) Write the source of energy for this replication and name the enzyme involved in this process.
(d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.
Answer:
(a) Replication fork
(b)

(c) Deoxy nucleotide, triphosphate acts as an energy source for replication. DNA polymerase is used for replication
(d) mRNA contacting information for protein synthesis will develop from DNA strand having polarity 5’ → 3’

Question 30.
If the coding sequence in a transcription unit is written as follows:
5’ TGCATGCATGCATGCATGCATGCATGC 3’
Write down the sequence of mRNA.
Answer:
mRNA sequence is 3’ACGUACGUACGUUCGUACGUACGUACG5’

Question 31.
How is the two-stage process of protein synthesis advantageous?
Answer:
The split gene feature of eukaryotic genes is almost entirely absent in prokaryotes. Originally each exon may have coded for a single polypeptide chain with a specific function. Since exon arrangement and intron removal are flexible, the exon coding for these polypeptide subunits act as domains combining in various ways to form new genes. Single genes can produce different functional proteins by arranging their exons in several different ways through alternate splicing patterns, a mechanism known to play an important role in generating both protein and functional diversity in animals. Introns would have arosen before or after the evolution of eukaryotic gene.

If introns arose late how did they enter eukaryotic gene? Introns are mobile DNA sequences that can splice themselves out of, as well as into, specific ‘target sites’ acting like mobile transposon-like elements (that mediate transfer of genes between organisms – Horizontal Gene Transfer – HGT). HGT occurs between lineages of prokaryotic cells, or from prokaryotic to eukaryotic cells and between eukaryotic cells. HGT is now hypothesized to have played a major role in the evolution of life on Earth.

Question 32.
Why did Hershey and Chase use radioactively labelled phosphorous and sulphur only? Would they have got the same result if they use radiolabelled carbon and nitrogen?
Answer:
Generally proteins contain sulphur but not phosphorous and nucleic acid (DNA) contains , phosphorous but not sulphur. Hence Hershey – Chase used radioactive isotopes of sulphur (³⁵S) and phosphorus (³²P) to keep separate track of viral protein and nucleic acid in culture medium. The expected result cannot be achieved, if radioactive carbon and nitrogen is used, since these molecules are present in both DNA and proteins.

Question 33.
Explain the formation of a nucleosome.
Answer:
Komberg proposed a model for the nucleosome, in which 2 molecules of the four histone proteins H2A, H2B, H3 and H4 are organized to form a unit of eight molecules called histone octamere.
The negatively charged DNA is wrapped around the positively charged histone octamere to form a structure called nucleosome. A typical nucleosome contains 200 bp of DNA helix. The histone octameres are in close contact and DNA is coiled on the outside of nucleosome.

Question 34.
It is established that RNA is the first genetic material. Justify giving reasons.
Answer:
Three molecular biologists in the early 1980’s (Leslie Orgel, Francis Brick and Carl Woese) independently proposed the ‘RNA world’ as the first stage in the evolution of life, a stage when RNA catalysed all molecules necessary for survival and replication. The term ‘RNA world’ first used by Walter Gilbert in 1986, hypothesizes RNA as the first genetic on Earth. There is now enough evidence to suggest that essential life processes (such as metabolism, translation and splicing etc.,) evolved around RNA. RNA has the ability to act as both genetic material and catalyst. There are several biochemical reactions in living systems that are catalyzed by RNA. This catalytic RNA is known as a ribozyme. But, RNA being a catalyst was reactive and hence unstable.

This led to the evolution of a more stable form of DNA, with certain chemical modifications. Since DNA is a double-stranded molecule having a complementary strand, it has resisted changes by evolving a process of repair. Some RNA molecules function as gene regulators by binding to DNA and affect gene expression. Some viruses use RNA as genetic material. Andrew Fire and Craig Mellow (recipients of the Nobel Prize in 2006) were of the opinion that RNA is an active ingredient in the chemistry of life.

Samacheer Kalvi 12th Bio Zoology Molecular Genetics Additional Questions and Answers

1 – Mark Questions

Question 1.
The term‘gene’was coined by ___________
Answer:
Wilhelm Johannsen

Question 2.
Whose experiment finally provided convincing evidence that DNA is the genetic material?
(a) Griffith experiment
(b) Avery, Macleod, and McCarty’s experiment
(c) Hershey-Chase experiment
(d) Urey-Miller’s experiment
Answer:
(c) Hershey-Chase experiment

Question 3.
In Hershey – Chase experiment, the DNA of T² phase was made radioactive by using ___________
(a) ³²P
(b) ³²S
(c) ³⁵P
(d) ³²S
Answer:
(a) ³²P

Question 4.
A nucleoside is composed of ___________
(a) Sugar and Phosphate
(b) Nitrogen base and Phosphate
(c) Sugar and a Nitrogen base
(d) Sugar, Phosphate, and Nitrogenous base
Answer:
(c) Sugar and a Nitrogen base

Question 5.
Identify the incorrect statement
(a) a base is a substance that accepts H+ ion
(b) Both DNA and RNA have four bases
(c) Purines have a single carbon-nitrogen ring
(d) Thymine is unique for DNA
Answer:
(c) Purines have a single carbon-nitrogen ring

Question 6.
Watson and Crick proposed their double helical DNA model based on the X-ray diffraction analysis of ___________
(a) Erwin Chargaff
(b) Meselson and Stahl
(c) Wilkins and Franklin
(d) Griffith
Answer:
(c) Wilkins and Franklin

Question 7.
The term ‘RNA world’ was first used by ___________
Answer:
Walter Gilbert

Question 8.
The distance between two consecutive base pairs in DNA is ___________
(a) 0.34 nm
(b) 3.4 nm
(c) 0.034 nm
(d) 34 nm
Answer:
(a) 0.34 nm

Question 9.
If the length of E. coli DNA is 1.36 mm, the number of base pairs is ___________
(a) 0.36 × 10⁶m
(b) 4 × 10⁶m
(c) 0.34 × 10^-9nm
(d) 4 × 10^-9m
Answer:
(b) 4 × 10⁶m

Question 10.
Identify the proper sequence in the organisation of the eukaryotic chromosome.
(a) Nucleosome – Solenoid – Chromatid
(b) Chromatid – Nucleosome – Solenoid
(c) Solenoid – chromatin – DNA
(d) Nucleosome – solenoid – genophore
Answer:
(a) Nucleosome – Solenoid – Chromatid

Question 11.
Assertion (A) : Genophore is noticed in prokaryotes.
Reason (R) : Bacteria possess circular DNA without chromatin organization.
(a) Both A and R are correct
(b) A is correct R is incorrect
(c) R explains A
(d) A is incorrect R is correct
Answer:
(c) R explains A

Question 12.
Assertion (A): Heterochromatin is transcriptionally active.
Reason (R): Tightly packed chromatin which stains dark.
(a) Both A and R are correct
(b) A is correct R is incorrect
(c) R explains A
(d) A is incorrect R is correct
Answer:
(d) A is incorrect R is correct

Question 13.
Assertion (A) : semi-conservative model was proposed by Hershey and Chase.
Reason (R) : The daughter DNA contains only new strands.
(a) Both A and R are incorrect
(b) A is correct R is incorrect
(c) R explains A
(d) A is incorrect R is correct
Answer:
(a) Both A and R are incorrect

Question 14.
Kornberg enzyme is called as _____
Answer:
DNA polymerase I

Question 15.
Replication of DNA occurs at __________ phase of cell cycle.
(a) M
(b) S
(c) G₁
(d) G₂
Answer:
(b) S

Question 16.
Semi-conservative model of replication was proved by __________
(a) Hershey and Chase
(b) Griffith
(c) Meselson and Stahl
(d) Macleod and McCarty
Answer:
(c) Meselson and Stahl

Question 17.
How many types of DNA polymerases does a eukaryotic cell possess?
(a) two
(b) three
(c) four
(d) five
Answer:
(d) Five

Question 18.
Identify the incorrect statement
(a) Replication occurs at ori – site of DNA
(b) Deoxy nucleotide triphosphate acts as a substrate
(c) Unwinding of DNA strand is carried out by topoisomerase
(d) DNA polymerase catalyses the polymerization at 3-OH
Answer:
(c) Unwinding of DNA strand is carried out by topoisomerase

Question 19.
The discontinuously synthesized fragments of lagging strand are called ________
Answer:
Okazaki fragments

Question 20.
Retroviruses possess ________ as genetic material.
Answer:
RNA

Question 21.
Which is NOT a part of the transcription unit?
(a) Promoter
(b) Operator
(c) Structural gene
(d) Terminator
Answer:
(b) Operator

Question 22.
Goldberg – Hogness box of eukaryotes is equivalent to ________ of prokaryotes.
Answer:
Pribnow box

Question 23.
Okazaki fragments are joined by the enzyme ________ during DNA replication.
Answer:
DNA ligase

Question 24.

Answer:
(a) A – iv, B – i, C – ii, D – iii

Question 25.
The RNA polymerase of prokaryotes binds with the factor to initiate polymerization.
(a) rho
(b) theta
(c) sigma
(d) psi
Answer:
(c) sigma

Question 26.

(a) Capping
(b) Tailing
(c) Splicing
(d) Transcribing
Answer:
(c) Splicing

Question 27.
Which of the following feature is absent in prokaryotes?
(a) Prokaryotes possess three major types of RNAs
(b) Structural genes are polycistronic
(c) Initiation process of transcription requires ‘P’ factor
(d) Split gene feature
Answer:
(d) Split gene feature

Question 28.
Which of the following sequence has completely translated?
(i) AGA, UUU, UGU, AGU, UAG
(ii) AUG, UUU, AGA, UAC, UAA
(iii) AAA, UUU, UUG, UGU, UGA
(iv) AUG,AAU,AAC,UAU,UAG
(a) i and ii
(b) ii only
(c) i and iii
(d) ii and iv
Answer:
(d) ii and iv

Question 29.
Capping of mRNA occurs using __________
(a) Poly A residues
(b) Methyl guanosine triphosphate
(c) Deoxy ribonucleotide triphosphate
(d) Ribonucleotide triphosphate
Answer:
(b) Methyl guanosine triphosphate

Question 30.
One of the aspects is not a feature of genetic code?
(a) Specific
(b) Degenerate
(c) Universal
(d) Ambiguous
Answer:
(d) Ambiguous

Question 31.
Which of the triplet codon is not a code of proline?
(i) CCU
(ii) CAU
(iii) CCG
(iv) CAA
(a) i only
(b) ii and iv
(c) iii only
(d) all the above
Answer:
(b) ii and iv

Question 32.
Coding sequences found in split genes are called.
(a) Operons
(b) Introns
(c) Exons
(d) Cistron
Answer:
(c) Exons

Question 33.
Which of the following mRNA yields 6 aminoacids after translation?
(i) UCU UAU AGU CGA UGC AGU UGA AAA UUU
(ii) UGA AGA UAG GAG CAU CCC UAC UAU GAU
(iii) GUC UGC UGG GCU GAU UAA AGG AGC AUU
(iv) AUG UAC CAU UGC UGA UGC AGG AGC CCG
Answer:
(i) UCU UAU AGU CGA UGC AGU UGA AAA UUU

Question 34.
The transcription termination factor associated with RNA polymerase in prokaryotes is
(a) θ
(b) σ
(c) ρ
(d) ∑
Answer:
(c) ρ

Question 35.
In a DNA double strand, if guanine is of 30%, what will be the percentage of thymine?
(a) 100%
(b) 20%
(c) 10%
(d) 70%
Answer:
(b) 20%

Question 36.
Identify the triplet pairs that code for Tyrosine
(a) UUU, UUC
(b) UAU, UAU
(c) UGC, UGU
(d) CAU, CAC
Answer:
(b) UAU, UAU

Question 37.

Answer:
A – ii B – i C – iv D – iii

Question 38.
AUG code is for __________
(a) Arginine
(b) Tyrosine
(c) Tryptophan
(d) Methionine
Answer:
(d) Methionine

Question 39.
The sequence of bases in the coding strand of DNA is G A G T  T A G C A G G C, then the sequence of codons in the primary transcript is
(a) C U C A U A C G C C C G
(b) C U C A A U C G U C C G
(c) U C A G A U C U G C G C
(d) U U C A A U C G U G C G
Answer:
(b) C U C A A U C G U C C G

Question 40.
The promoter region of eukaryote is __________
(a) TATAA
(b) AUGUT
(c) UUUGA
(d) AAAAU
Answer:
(a) TATAA

Question 41.
Match the following:
(A) AUG – (i) Tyrosine
(B) UGA – (ii) Glycine
(C) UUU – (iii) Methionine
(D) GGG – (iv) Phenylalanine
(a) A – iii B – i C – iv D – ii
(b) A – iii B – ii C – i D – iv
(c) A – iv B – i C – iii D – ii
(d) A – ii B – i C – iv D – iii
Answer:
(d) A – ii B – i C – iv D – iii

Question 42.
__________ number of codons, codes for cystine.
Answer:
Two

Question 43.
In sickle cell anaemia, the __________ codon of β – globin gene is modified.
(a) Eighth
(b) Seventh
(c) Sixth
(d) Nineth
Answer:
(c) Sixth

Question 44.
Pick out the incorrect statement.
(a) tRNA acts as a adapter molecule
(b) Stop codons donot have tRNA’s
(c) Addition of aminoacid leads to hydrolysis of tRNA
(d) tRNA has four major loops
Answer:
(c) Addition of aminoacid leads to hydrolysis of tRNA

Question 45.
Which of the following antibiotic inhibits the interaction between tRNA and mRNA?
(a) Neomycin
(b) Streptomycin
(c) Tetracycline
(d) Chloramphenicol
Answer:
(a) Neomycin

Question 47.
The cluster of genes with related function is called _________
(a) Cistron
(b) Operon
(c) Muton
(d) Recon
Answer:
(b) Operon

Question 48.
Repressor protein of Lac operon binds to __________ of operon.
(a) Promoter region
(b) Operator region
(c) terminator region
(d) inducer region
Answer:
(b) Operator region

Question 49.
Lac Z gene codes for __________
(a) Permease
(b) transacetylase
(c) β -galactosidase
(d) Aminoacyl transferase
Answer:
(c) β -galactosidase

Question 50.
Lac operon model was proposed by __________
Answer:
Jacob and Monod

Question 51.
Approximate count of base pair in human genome is __________
Answer:
3 × 10⁹ bp

Question 52.
Automated DNA sequences are developed by.
Answer:
Frederick Sanger

Question 53.
Which of the chromosome has higher gene density?
(a) Chromosome 20
(b) Chromosome 19
(c) Chromosome 13
(d) Chromosome Y
Answer:
(b) Chromosome 19

Question 54.
Number of genes located in chromosome Y is __________
(a) 2968
(b) 213
(c) 2869
(d) 231
Answer:
(d) 231

Question 55.
How many structural genes are located in lac operon of E.Coli?
(a) 4
(b) 3
(c) 2
(d) 1
Answer:
(b) 3

Question 56.
DNA finger printing technique was developed by
(a) Jacob and Monod
(b) Alec Jeffreys
(c) Frederick Sanger
Answer:
(b) Alec Jeffreys

Question 57.
In DNA fingerprinting, separation of DNA fragments is done by __________
(a) Centrifugation
(b) Electrophoresis
(c) X-ray diffraction
(d) denaturation
Answer:
(b) Electrophoresis

Question 58.
SNP stands for
(a) Single nucleotide Polymorphism
(b) Single Nucleoside Polypeptide
(c) Single nucleotide Polymorphism
(d) Single nucleotide polymer
Answer:
(a) Single nucleotide Polymorphism

Question 59.
Specific sequences of mRNA that are not translated are __________
Answer:
UnTranslated Regions (UTR)

Question 60.
Non-coding or intervening DNA sequence is called __________

Question 61.
_______ Intron is the monomer of DNA.
Answer:
Nucleotide

Question 62.
Which one of the following is wrongly matched?
(a) Transcription – Copying information from DNA to RNA
(b) Translation – Decoding information from mRNA to protein
(c) Replication – Making of DNA copies
(d) Splicing – Joining of exons with introns
Answer:
(d) Splicing – Joining of exons with introns

2- Mark Questions

Question 1.
Who proposed One gene – One enzyme hypothesis? Define it.
Answer:
George Beadle and Edward Tatum proposed One gene – One enzyme hypothesis which states that one gene controls the production of one enzyme.

Question 2.
Differentiate nucleoside from nucleotide.
Answer:

1. Nucleoside: Nucleoside subunit is composed of nitrogenous bases linked to a pentose sugar molecule.
2. Nucleotide: Nucleotide subunit is composed of nitrogenous bases, a pentose sugar and a phosphate group.

Question 3.
State the key differences between DNA and RNA.
Answer:
DNA:

1. DNA is made of deoxyribose sugar.
2. Nitrogenous bases of DNA are Adenine, Guanine, Cytosine and Thymine.

RNA:

1. RNA is made of ribose sugar.
2. Nitrogenous bases of RNA are Adenine, Guanine, Cytosine and Uracil.

Question 4.
Point out the nitrogenous bases of RNA.
Answer:
Adenine, Guanine, Cytosine and Uracil.

Question 5.
What makes the DNA and RNA as acidic molecules?
Answer:
The phosphate functional group (PO₄) gives DNA and RNA the property of an acid at physiological pH, hence the name nucleic acid.

Question 6.
Which type of bond is formed

1. between a purine and pyrimidine base?
2. between the pentose sugar and adjacent nucleotide?

Answer:

1. Purine and pyrimidine bases are linked by hydrogen bonds.
2. Pentose sugar is linked to adjacent nucleotide by phosphodiester bonds.

Question 7.
DNA acts as genetic material for majority of living organisms and not the RNA. Give reasons to support the statement.
Answer:

1. RNA was reactive and hence highly unstable.
2. Some RNA molecules acts as gene regulators by binding to DNA and affect gene expression.
3. Uracil of RNA is less stable than thymine of DNA.

Question 8.
Name any two viruses whose genetic material is RNA.
Answer:

1. Tobacco Mosaic Virus (TMV)
2. Bacteriophage 0B

Question 9.
What are the properties that a molecule must possess to act as genetic material?
Answer:

1. Self replication
2. Information storage
3. Stability
4. Variation through mutation

Question 10.
How many base pairs are present in one complete turn of DNA helix? What is the distance between two consecutive base pairs?
Answer:
There are ten base pairs in each turn with a distance of 0.34 x 109m between two adjacent base pairs.

Question 11.
What is a genophore?
Answer:
In prokaryotes such as E. coli though they do not have defined nucleus, the DNA is not scattered throughout the cell. DNA (being negatively charged) is held with some proteins (that have positive charges) in a region called the nucleoid. The DNA as a nucleoid is organized into large loops held by protein. DNA of prokaryotes is almost circular and lacks chromatin organization, hence termed genophore.

Question 12.
Whqt is nucleosome? How many base pairs are there in a typical nucleosome?
Answer:
The negatively charged DNA is wrapped around the positively charged histone octamere to form a structure called nucleosome. A typical nucleosome contains 200 bp of DNA helix.

Question 13.
Expand and define NHC
Answer:

1. NHC : Non-histone Chromosomal protein.
2. In eukaryotes, apart from histone proteins, additional set of proteins are required for packing of chromatin at higher level and are referred as non – histone chromosomal proteins.

Question 14.
Differentiate between Heterochromatin and Euchromatin.
Answer:
Heterochromatin:

1. Region of nucleus where the chromatin are loosely packed and stains light are called Heterochromatin.
2. Transcriptionally inactive.

Euchromatin:

1. Region of nucleus where the chromatin are tightly packed and stains dark are called Euchromatin.
2. Transcriptionally active.

Question 15.
Which is the widely accepted model of DNA replication? Who has proved it?
Answer:
Semi-conservative replication model. It was proved by Meselson and Stahl in 1958.

Question 16.
Name the chemical substance which is called by the name

1. Kornberg Enzyme
2. Ochoa’s enzyme

Answer:

1. DNA polymerase I is also known as Komberg enzyme.
2. Polynucleotide phosphorylase is also known as Ochoa’s enzyme.

Question 17.
Name the various types of prokaryotic DNA polymerase. State their role in replication process.
Answer:

1. DNA Polymerase I Involver in DNA repair mechanism
2. DNA Polymerase II Involver in DNA repair mechanism
3. DNA Polymerase III Involver in DNA replication

Question 18.
What is the function of Deoxy nucleotide triphosphate in replication?
Answer:
Deoxy nucleotide triphosphate acts as substrate and also provides energy for polymerization reaction.

Question 19.
Given below are some events of eukaryotic replication. Name the enzymes involved in the process.

1. Unwinding of DNA
2. Joining of Okazaki fragments
3. Addition of nucleotides to new strand
4. Correcting the repair

Answer:

1. Helicase
2. DNA ligase
3. DNA polymerase
4. Nuclease

Question 20.
Differentiate leading strand from lagging strand
Answer:
Leading strand:

1. Leading strand has the polarity 3’ → 5’.
2. Replication is continuous.

Lagging strand:

1. Lagging strand has the polarity 5’ → 3’.
2. Replication is discontinuous.

Question 21.
What are Okazaki fragments?
Answer:
The discontinuously synthesized fragments of the lagging strand are called the Okazaki fragments are joined by the enzyme DNA ligase.

Question 22.
What is a replication fork?
Answer:
At the point of origin of replication, the helicases and topoisomerases (DNA gyrase) unwind and pull apart the strands, forming a Y-Shaped structure called the replication fork. There are two replication forks at each origin.

Question 23.
Apart from DNA polymerase, name any other four enzymes which were involved in DNA replication of eukaryotic cell.
Answer:
DNA ligase, Topoisomerase (DNA gyrase), Helicase and Nuclease.

Question 24.
Who proposed the central dogma? Write its concept.
Answer:
Francis Crick proposed the Central dogma in molecular biology which states that genetic information flows as follows:

Question 25.
Define transcription and name the enzyme involved in this process.
Answer:
The process of copying genetic information from one strand of DNA into RNA is termed transcription. This process takes place in presence of DNA-dependent RNA polymerase.

Question 26.
What is TATA box? State its function.
Answer:
In eukaryotes, the promoter has AT-rich regions called TATA box or Goldberg-Hogness box. It acts as a binding site for RNA polymerase.

Question 27.
Structural gene of eukaryotes differ from prokaryotes. How?
Answer:
In eukaryotes, the structural gene is monocistronic coding for only one protein whereas in prokaryotes the structural gene is polycistronic coding for many proteins.

Question 28.
What are the two major components of prokaryotic RNA polymerase? How do they act?
Answer:
Bacterial (prokaryotic) RNA polymerase consists of two major components, the core enzyme and the sigma subunit. The core enzyme (β1, β, and α) is responsible for RNA synthesis ” whereas a sigma subunit is responsible for recognition of the promoter.

Question 29.
Distinguish between exons and introns.
Answer:

1. Exons: Expressed sequences (Coding sequences) of an eukaryotic gene
2. Introns: Interveining sequences (non-coding sequences) of an eukaryotic gene

Question 30.
Define splicing.
Answer:
The process of removing introns from hnRNA is called splicing.

Question 31.
What is capping and tailing?
Answer:
In capping an unusual nucleotide, methyl guanosine triphosphate is added at the 5’ end of hnRNA, whereas adenylate residues (200-300) (Poly A) are added at the 3’ end in tailing.

Question 32.
If a double stranded DNA has 20% of cytosine, calculate the percentage of adenine in DNA.
Answer:
Cytdsine = 20, hence Guanine = 20
As per ChargafFs rule (A+T) = (G+C) =100
Percent of Thymine + Adenine = 20 + 20 = 100
(T + A) = (20 + 20) =100
(T + A)=100-(20 + 20)
T +A = 100 – 40
T + A = 60
Therefore the percent of Adenine will be 60/2 = 30%.

Question 33.
Mention the dual functions of AUG.
Answer:
AUG has dual functions. It acts as a initiator codon and also codes for the amino acid methionine.

Question 34.
How many codons are involved in termination of translation. Name them.
Answer:
Three codons terminate translation process. They are UAA, UAG and UGA.

Question 35.
Degeneracy of codon – comment.
Answer:
A degenerate code means that more than one triplet codon could code for a specific amino acid. For example, codons GUU, GUC, GUA and GUG code for valine.

Question 36.
Point out the exceptional categories to universality of genetic code.
Answer:
Exceptions to universal nature of genetic code is noticed in prokaryotic mitochondrial and chloroplast genomes.

Question 37.
What are non-sense codons?
Answer:
UGA, UAA and UAG are the non-sense codons, which terminates translation.

Question 38.
Name the triplet codons that code for

1. Tyrosine
2. Histidine

Answer:

1. Tyrosine – UAU, UAC
2. Histidine – CAU, CAC

Question 39.
Why hnRNA has to undergo splicing?
Answer:
Since hnRNA contains both coding sequences (exons) and non-coding sequences (introns) it has to undergo splicing to remove introns.

Question 40.
State the role of following codons in translation process

1. AUG
2. UAA

Answer:

1. AUG is the initiator codon and also codes for methionine.
2. UAA is a terminator codon.

Question 41.
Given below is mRNA sequence. Mention the aminoacids sequence that is formed after its translation.
Answer:
3’AUGAAAGAUGGGUAA5’
Methionine – Lysine – Aspartic acid – Glycine

Question 42.
Name the four codons that codes valine.
Answer:
GUU, GUC, GUA and GUG.

Question 43.
The base sequence in one of the DNA strand is TAGC ATGAT. Mention the base sequence in its complementary strand.
Answer:
The complementary strand has ATCGTACTA.

Question 44.
Why t-RNA is called as adapter molecule?
Answer:
The transfer RNA (tRNA) molecule of a cell acts as a vehicle that picks up the amino acids scattered through the cytoplasm and also reads specific codes of mRNA molecules. Hence it is called as adapter molecule.

Question 45.
What do you mean by charging of tRNA? Name the enzyme involved in this process.
Answer:
The process of addition of amino acid to tRNA is known as aminoacylation or charging and the resultant product is called aminoacyl- tRNA (charged tRNA). Aminoacylation is catalyzed by an enzyme aminoacyl – tRNA synthetase.

Question 46.
What are UTR’s?
Answer:
mRNA also have some additional sequences that are not translated and are referred to as Untranslated Regions (UTR). UTRs are present at both 5’ end (before start codon) and at 3’ end (after stop codon).

Question 47.
What is S – D sequence?
Answer:
The 5’ end of the mRNA of prokaryotes has a special sequence which precedes the initial AUG start codon of mRNA. This ribosome binding site is called the Shine – Dalgamo sequence or S-D sequence. This sequences base-pairs with a region of the 16Sr RNA of the small ribosomal subunit facilitating initiation.

Question 48.
Define translation unit.
Answer:
A translation unit in mRNA is the sequence of RNA that is flanked by the start codon on 5’ end and stop codon on 3’ end and codes of polypeptide.

Question 49.
Mention the inhibitory role of tetracycline and streptomycin in bacterial translation.
Answer:
Tetracycline inhibits binding between aminoacyl tRNA and mRNA.Streptomycin inhibits initiation of translation and causes misreading.

Question 50.
At what stage, does the gene expression is regulated?
Answer:
Gene expression can be controlled or regulated at transcriptional or translational levels.

Question 51.
What is an operon? Give example.
Answer:
The cluster of genes with related functions is called an operon.
E.g: lac operon in E.coli.

Question 52.
Considering the lac operon of E.coli, name the products of the following genes.

1. i gene
2. lac Z gene
3. lac Y gene
4. lac a gene

Answer:

1. i gene – repressor protein
2. lac Z gene – fS-galactosidase
3. Lac Y gene – Permease
4. lac a gene – transacetylase

Question 53.
Expand

1. ETS
2. YAC.

Answer:

1. ETS : Expressed Sequence Tags
2. YAC : Yeast Artificial Chromosomes

Question 54.
Name the human chromosome that has

1. most number of genes
2. least number of genes

Answer:

1. Chromosome 1 has maximum number of genes (2968 genes)
2. Chromosome Y has least genes (231 genes)

Question 55.
What are SNPs? Mention its uses.
Answer:
SNPs : Single nucleotide polymorphism. It helps to find chromosomal locations for disease associated sequences and tracing human history.

Question 56.
Mention any four areas where DNA fingerprinting can be used.
Answer:

1. Forensic analysis
2. Pedigree analysis
3. Conservation of wild life
4. Anthropological studies

3 – Mark Questions

Question 57.
Classify nucleic acid based on sugar molecules.
Answer:
There are two types of nucleic acids depending on the type of pentose sugar. Those containing deoxyribose sugar are called Deoxyribo Nucleic Acid (DNA) and those with ribose sugar are known as Ribonucleic Acid (RNA). The only difference between these two sugars is that there is one oxygen atom less in deoxyribose.

Question 58.
Both purines and pyrimidines are nitrogen bases yet they differ. How?
Answer:
Both purines and pyrimidines are nitrogen bases. The purine bases Adenine and Guanine have double carbon – nitrogen ring, whereas cytosine and thymine bases have single carbon nitrogen ring.

Question 59.
How 5’ of DNA differ from its 3’?
Answer:
The 5’ of DNA refers to the carbon in the sugar to which phosphate (P04V) functional group is attached. The 3’ of DNA refers to the carbon in the sugar to which a hydroxyl (OH) group is attached.

Question 60.
State Chargaff’s rule.
Answer:
According to Erwin Chargaff,

1. Adenine pairs with Thymine with two hydrogen bonds.
2. Guanine pairs with Cytosine with three hydrogen bonds.

Question 61.
Chemically DNA is more stable than RNA – Justify.
Answer:
In DNA, the two strands being complementary, if separated (denatured) by heating can come together (renaturation) when appropriate condition is provided. Further 2 OH group present at every nucleotide in RNA is a reactive group that makes RNA liable and easily degradable. RNA is also known to be catalytic and reactive. Hence, DNA is chemically more stable and chemically less reactive when compared to RNA. Presence of thymine instead of uracil in DNA confers additional stability to DNA.

Question 62.
Write in simple about semi-conservative mode of DNA replication.
Answer:
Semi-conservative replication was proposed by Watson and Crick in 1953. This mechanism of replication is based on the DNA model. They suggested that the two polynucleotide strands of DNA molecule unwind and start separating at one end. During this process, covalent hydrogen bonds are broken. The separated single strand then acts as template for the synthesis of a new strand. Subsequently, each daughter double helix carries one polynucleotide strand from the parent molecule that acts as a template and the other strand is newly synthesised and complementary to the parent strand.

Question 63.
Draw a simplified diagram of nucleosome and label it.
Answer:

Question 64.
What is a primer?
Answer:
A primer is a short stretch of RNA. It initiates the formation of new strand. The primer produces 3’-OH end on the sequence of ribonucleotides, to which deoxyribonucleotides are added to form a new strand.

Question 65.
Both strands of DNA are not copied during transcription. Give reason.
Answer:
Both the strands of DNA are not copied during transcription for two reasons.

1. If both the strands act as a template, they would code for RNA with different sequences. This in turn would code for proteins with different amino acid sequences. This would result in one segment of DNA coding for two different proteins, hence complicate the genetic information transfer machinery.
2. If two RNA molecules were produced simultaneously, double stranded RNA complementary to each other would be formed. This would prevent RNA from being translated into proteins.

Question 66.
What do you mean by a template strand and coding strand?
Answer:
DNA dependent RNA polymerase catalyses the polymerization in only one direction, the strand that has the polarity 3’→ 5’ acts as a template, and is called the template strand. The other strand which has the polarity 5’→ 3’ has a sequence same as RNA (except thymine instead of uracil) and is displaced during transcription. This strand is called coding strand.

Question 67.
Name the factors that are responsible for initiation and termination of transcription in prokaryotes.
Answer:

1. Sigma factor is responsible for initiation of transcription.
2. Rho factor is responsible for termination of transcription.

Question 68.
Name the major RNA types of prokaryotes and mention their role.
Answer:
In prokaryotes, there are three major types of RNAs: mRNA, tRNA, and rRNA. All three \ RNAs are needed to synthesize a protein in a cell. The mRNA provides the template, tRNA brings amino acids and reads the genetic code, and rRNAs play structural and catalytic role
during translation.

Question 69.
Define genetic code.
Answer:
The order of base pairs along DNA molecule controls the kind and order of amino acids found in the proteins of an organism. This specific order of base pairs is called genetic code.

Question 70.
Explain Wobble hypothesis.
Answer:
Wobble Hypothesis is proposed by Crick (1966) which states that tRNA anticodon has the ability to wobble at its 5’ end by pairing with even non-complementary base of mRNA codon.’ According to this hypothesis, in codon-anticodon pairing the third base may not be complementary.

The third base of the codon is called wobble base and this position is called wobble position. The actual base pairing occurs at first two positions only. The importance of Wobbling hypothesis is that it reduces the number of tRNAs required for polypeptide synthesis and it overcomes the effect of code degeneracy.

Question 71.
Explain the nature of eukaryotic ribosome.
Answer:
The ribosomes of eukaryotes (80 S) are larger, consisting of 60 S and 40 S sub units. ‘S’ denotes the sedimentation efficient which is expressed as Svedberg unit (S). The larger subunit in eukaryotes consist of a 23 S RNA and 5Sr RNA molecule and 31 ribosomal proteins. The smaller eukaryotic subunit consist of 18Sr RNA component and about 33 proteins.

Question 72.
Expand and define ORF.
Answer:
Any sequence of DNA or RNA, beginning with a start codon and which can be translated into a protein is known as an Open Reading Frame (ORF).

Question 73.
What are the components of initiation complex of prokaryotic translation?
Answer:
Initiation of translation in E. coli begins with the formation of an initiation complex, consisting of the 30S subunits of the ribosome, a messenger RNA and the charged N-formyl methionine tRNA (f^met -1 RNA f^met), three proteinaceous initiation factors (IF 1, IF2, IF3), GTP (Guaniner Tri Phosphate) and Mg ²⁺.

Question 74.
Explain the components of operon.
Answer:
Structure of the operon: Each operon is a unit of gene expression and regulation and consists
of one or more structural genes and an adjacent operator gene that controls transcriptional
activity of the structural gene.

1. The structural gene codes for proteins, rRNA and tRNA required by the cell.
2. Promoters are the signal sequences in DNA that initiate RNA synthesis. RNA polymerase I binds to the promoter prior to the initiation of transcription.
3. The operators are present between the promoters and structural genes. The repressor protein binds to the operator region of the operon.

5 – Mark Question

Question 75.
Describe Hershey and Chase experiment. What is concluded by their experiment?
Answer:
Alfred Hershey and Martha Chase (1952) conducted experiments on bacteriophages that infect bacteria. Phage T₂ is a virus that infects the bacterium Escherichia coli. When phages (virus) are added to bacteria, they adsorb to the outer surface, some material enters the bacterium, and then later each bacterium lyses to release a large number of progeny phage. Hershey and Chase wanted to observe whether it was DNA or protein that entered the bacteria. All nucleic acids contain phosphorus, and contain sulphur (in the amino acid cysteine and methionine). Hershey and Chase designed an experiment using radioactive isotopes of Sulphur (³⁵S) and phosphorus (³²P) to keep separate track of the viral protein and nucleic acids during the infection process.

The phages were allowed to infect bacteria in culture medium which containing the radioactive isotopes ³⁵S or ³²P. The bacteriophage that grew in the presence of ³⁵S had labelled proteins and bacteriophages grown in the presence of ³²P had labelled DNA. The differential labelling thus enabled them to identity DNA and proteins of the phage. Hershey and Chase mixed the labelled phages with unlabeled E. coli and allowed bacteriophages to attack and inject their genetic material. Soon after infection (before lysis of bacteria), the bacterial cells were gently agitated in a blender to loosen the adhering phase particles.

It was observed that only ³²P was found associated with bacterial cells and ³⁵S was in the surrounding medium and not in the bacterial cells. When phage progeny was studied for radioactivity, it was found that it carried only ³²P and not ³⁵ S. These results clearly indicate that only DNA and not protein coat entered the bacterial cells. Hershey and Chase thus conclusively proved that it was DNA, not protein, which carries the hereditary information from virus to bacteria.

Question 76.
Explain the properties of DNA that makes it an ideal genetic material.
Answer:
1. Self Replication: It should be able to replicate. According to the rule of base pairing and complementarity, both nucleic acids (DNA and RNA) have the ability to direct duplications. Proteins fail to fulfill this criterion.

2. Stability: It should he stable structurally and chemically. The genetic material should be stable enough not to change with different stages of life cycle, age or with change in physiology of the organism. Stability as one of the properties of genetic material was clearly evident in Griffith’s transforming principle. Heat which killed the bacteria did not destroy some of the properties of genetic material. In DNA the two strands being complementary.

if separated (denatured) by heating can come together (renaturation) when appropriate condition is provided. Further 2’ OH group present at every nucleotide in RNA is a reactive group that makes RNA liable and easily degradable. RNA is also known to be catalytic and reactive. Hence, DNA is chemically more stable and chemically less reactive when compared to RNA. Presence of thymine instead of uracil in DNA confers additional stability to DNA.

3. Information storage: It should be able to express itself in the form of ‘Mendelian characters’. RNA can directly code for protein synthesis and can easily express the characters. DNA, however depends on RNA for synthesis of proteins. Both DNA and RNA can act as a genetic material, but DNA being more stable stores the genetic information and RNA transfers the genetic information.

4. Variation through mutation: It should be able to mutate. Both DNA and RNA are able to mutate. RNA being unstable mutates at a faster rate. Thus viruses having RNA genome with shorter life span can mutate and evolve faster. The above discussion indicates that both RNA and DNA can function as a genetic material. DNA is more stable, and is preferred for storage of genetic information.

Question 77.
How the DNA is packed in a eukaryotic cell? ft
Answer:
In eukaryotes, organization is more complex. Chromatin is formed by a series of repeating units called nucleosomes. Komberg proposed a model for the nucleosome, in which 2 molecules of the four histone proteins H2A, H2B, H3 and H4 are organized to form a unit of eight molecules called histone octamere. The negatively charged DNA is wrapped around the positively charged histone octamere to form a structure called a nucleosome. A typical nucleosome contains 200 bp of DNA helix. The histone octameres are in close contact and DNA is coiled on the outside of the nucleosome. Neighbouring nucleosomes are connected by linker DNA (HI) that is exposed to enzymes.

The DNA makes two complete turns around the histone octameres and the two turns are sealed off by an HI molecule. Chromatin lacking HI has a beads-on-a-string appearance in which DNA inters and leaves the nucleosomes at random places. HI of one nucleosome can interact with 33l of the neighbouring nucleosomes resulting in the further folding of the fibre.

The chrof&atin fiber in interphase nuclei and mitotic chromosomes have a diameter that vary between 200-300 nm and represents inactive chromatin. 30 nm fibre arises from the folding of nucfeosbme, chains into a solenoid structure having six nucleosomes per turn. This structure is stabilized by interaction between different HI molecules. DNA is a solenoid and packed about,%)_folds. The hierarchical nature of chromosome structure is illustrated.

Additional set of proteins are required for packing of chromatin at higher level and are referred to as non-histone chromosomal proteins (NHC). In*,a typical nucleus, some regions of chromatin are Ibosely packed (lightly stained) and are referred to as euchromatin. The chromatin that is,-tightly packed (stained darkly) is called heterochromatin. Euchromatin is transcriptionally active and heterochromatin is transcriptionally inactive.

Question 78.
Meselson and Stahl’s experiment proved the semi-coflBptervation mode of DNA replication. Explain.
Answer:
The mode of DNA replication was determined in 1958 by Meselson and Stahl. They designed an experiment to distinguish between semi-conservative, conservative and dispersive replications. In their experiment, they grew two cultures of E.coli for many generations in separate media. The ‘heavy’ culture was grown in a medium in which the nitrogen source (NH4CI) contained the heavy isotope ¹⁵N and the ‘ light’ culture was grown in a medium in which the nitrogen source contained light isotope ¹⁴H for many generations. At the end of growth, they observed that the bacterial DNA in the heavy culture contained only ¹⁵N and in the light culture only ¹⁴N. The heavy DNA could be distinguished from light DNA (¹⁵N from ¹⁴N) with a technique called Cesium Chloride (CsCl) density gradient centrifugation. In this process, heavy and light DNA extracted from cells in thtytwo cultures settled into two distinct and separate bands (hybrid DNA).

The heavy culture (¹⁵N) was then transferred into a medium that had only NH4CI, and took samples at various definite time intervals (20 minutes duration). After the first replication, they extracted DNA and subjected it to density gradient centrifugation. The DNA settled into a band that was intermediate in position between the previously determined heavy and light bands. After the second replication (40 minutes duration), they again extracted DNA samples,and this time found the DNA settling into two bands, one at the light band position and one at intermediate position. These results confirm Watson and Crick’s semi-conservative replication hypothesis.

Question 79.
Give a detailed account of a transcription unit.
Answer:
A transcriptional unit in DNA is defined by three regions, a promoter, the structural gene and a terminator. The promoter is located towards the 5 ’ end. It is a DNA sequence that provides binding site for RNA polymerase. The presence of promoter in a transcription unit, defines the template and coding strands. The terminator region located towards the 3’ end of the coding strand contains a DNA sequence that causes the RNA polymerase to stop transcribing. In eukaryotes the promoter has AT rich regions called TATA box (Goldberg- Hogness box) ‘ and in prokaryotes this region is called Pribnow box.

Besides promoter, eukaryotes also require an enhancer. The two strands of the DNA in the structural gene of a transcription unit have opposite polarity. DNA dependent RNA polymerase catalyses the polymerization in only one direction, the strand that has the polarity 3’→5’ acts as a template, and is called the template strand. The other strand which has the polarity 5’→ 3’ has a sequence same as RNA (except thymine instead of uracil) and is displaced during transcription. This strand is called coding strand

The structural gene may be monocistronic (eukaryotes) or polycistronic (prokaryotes). In eukaryotes, each mRNA carries only a single gene and encodes information for only a single protein and is called monocistronic mRNA. In prokaryotes, clusters of related genes, known as operon, often found next to each other on the chromosome are transcribed together to give a single mRNA and hence are polycistronic.

Question 80.
Explain the transcription process in prokaryotes with the needed diagram.
Answer:
In prokaryotes, there are three major types of RNAs:
mRNA, tRNA, and rRNA. All three RNAs are needed to synthesize a protein in a cell. The mRNA provides the template, tRNA brings amino acids and reads the genetic code, and rRNAs play a structural and catalytic role during translation. There is a single DNA-dependent RNA polymerase that catalyses the transcription of all types of RNA. It binds to the promoter and initiates transcription (Initiation).

The polymerase binding sites are called promoters. It uses nucleoside triphosphate as substrate and polymerases in a template dependent fashion following the rule of complementarity. After the initiation of transcription, the polymerase continues to elongate the RNA, adding one nucleotide after another to the growing RNA chain. Only a short stretch of RNA remains bound to the enzyme, when the polymerase reaches a terminator at the end of a gene, the, nascent RNA falls off, so also the RNA polymerase. The RNA polymerase is only capable of catalyzing the process of elongation. The RNA polymerase associates transiently with initiation factor sigma (a) and termination factor rho (p) to initiate and terminate the transcription, respectively.

Association of RNA with these factors instructs the RNA polymerase either to initiate or terminate the process of transcription. In bacteria, since the mRNA does not require any processing to become active and also since transcription and translation take place simultaneously in the same compartment since there is no separation of cytosol and nucleus in bacteria), many times the translation can begin much before the mRNA is fully transcribed. This is because the genetic material is not separated from other cell organelles by a nuclear membrane consequently; transcription and translation can be coupled in bacteria.

Question 81.
Write the salient features of genetic code.
Answer:
The salient features of genetic code are as follows:

1. The genetic codon is a triplet code and 61 codons code for amino acids and 3 codons do not code for any amino acid and function as a stop codon (Termination).
2. The genetic code is universal. It means that all known living systems use nucleic acids and the same three base codons (triplet codon) direct the synthesis of protein from amino acids. For example, the mRNA (UUU) codon codes for phenylalanine in all cells of all organisms. Some exceptions are reported in prokaryotic, mitochondrial and chloroplast genomes. However, similarities are more common than differences.
3. A non-overlapping codon means that the same letter is not used for two different codons. For instance, the nucleotide sequence GUTJ and GUC represents only two codons.
4. It is comma less, which means that the message would be read directly from one end to the other i.e., no punctuation are needed between two codes.
5. A degenerate code means that more than one triplet codon could code for a specific amino acid. For example, codons GUU, GUC, GUA, and GUG code for valine.
6. Non-ambiguous code means that one codon will code for one amino acid.
7. The code is always read in a fixed direction i.e. from 5’→3’ direction called polarity.
8. AUG has dual functions. It acts as an initiator codon and also codes for the amino acid methionine.
9. UAA, UAG (tyrosine) and UGA (tryptophan) codons are designated as termination (stop) codons and also are known as “non-sense” codons.

Question 82.
Mutations in genetic code affect the phenotype. Describe with an example.
Answer:
The simplest type of mutation at the molecular level is a change in nucleotide that substitutes one base for another. Such changes are known as base substitutions which may occur spontaneously or due to the action of mutagens. A well-studied example is sickle cell anaemia in humans which results from a point mutation of an allele of β-hemoglobin gene (βHb).

A haemoglobin molecule consists of four polypeptide chains of two types, two a chains and two P-chains. Each chain has a heme group on its surface. The heme groups are involved in the binding of oxygen. The jruman blood disease, sickle cell anaemia is due to abnormal haemoglobin. This abnormality in hemoglobin is due to a single base substitution at the sixth codon of the beta globingene from GAG to GTG in p -chain of haemoglobin.

It results in a change of amino acid glufeniic acid to valine at the 6th position of the p -chain. This is the classical example of point mutation that results in the change of amino acids residue glutamic acid to valine. The mutant haemoglobin undergoes polymerisation under oxygen tension causing the change in the shape of the RBC from biconcave to a sickle shaped structure.

Question 83.
Explain the mechanism of AteArperon of the E-coli.
Answer:
The Lac (Lactose) operon: The metabolism of lactose in E.coli requires three enzymes – permease, P-galactosidase (P-gat) and transacetylase. The enzyme permease is needed for entry of lactose into the cell, Pjgglactosidase brings about hydrolysis of lactose to glucose and galactose, while transacety transfers acetyl group from acetyl Co A to P-galactosidase. The lac operon consists of one-regulator gene (T gene refers to inhibitor) promoter sites (p), and operator site (o). Besides these, it has three structural genes namely lac z, y and lac a. The lac ‘z’ gene codes for P-gaiaqtttsidase, lac ‘y’ gene codes for permease and ‘a’ gene codes for transacetylase.

Jacob and Monod proposed the classical model of Lac operon to explain gene expression and regulation in E.coli. In lac a polycistronic structural gene is regulated by a common promoter and regulatory genfc When the cell is using its normal energy source as glucose, the ‘i’ gene transcribes a repressor mRNA and after its translation, a repressor protein is produced. It binds to the operator region of the operon and prevents translation, as a result, P-galactosidase is not produced. In the absence of preferred carbon source such as glucose, if lactose is available as an energy source for the bacteria then lactose enters the cell as a result of permease enzyme. Lactose acts as an inducer and interacts with the repressor to inactivate it.

The repressor protein binds to the operator of the operon and prevents RNA polymerase from transcribing the operon. In the presence of inducer, such as lactose or allolactose, the repressor is inactivated by interaction with the inducer. This allows RNA polymerase to bind to the promotor site and transcribe the operon to produce lac mRNA which enables formation of all the required enzymes needed for lactose metabolism. This regulation of lac operon by the repressor is an example of negative control of transcription initiation.

Question 84.
What are the objectives of Human Genome project?
Answer:
The main goals of Human Genome Project are as follows:

1. Identify all the genes (approximately 30000) in human DNA.
2. Determine the sequence of the three billion chemical base pairs that makeup the human DNA.
3. To store this information in databases.
4. Improve tools for data analysis.
5. Transfer related technologies to other sectors, such as industries.
6. Address the ethical, legal and social issues (ELSI) that may arise from the project.

Question 85.
Write the salient features of Human Genome Project.
Answer:

1. Although human genome contains 3 billion nucleotide bases, the DNA sequences that encode proteins make up only about 5% of the genome.
2. An average gene consists of 3000 bases, the largest known human gene being dystrophin with 2.4 million bases.
3. The function of 50% of the genome is derived from transposable elements such as LINE and ALU sequence.
4. Genes are distributed over 24 chromosomes. Chromosome 19 has the highest gene density. Chromosome 13 and Y chromosome have lowest gene densities.
5. The chromosomal organization of human genes shows diversity.
6. There may be 35000-40000 genes in the genome and almost 99.9 nucleotide bases are exactly the same in all people.
7. Functions for over 50 percent of the discovered genes are unknown.
8. Less than 2 percent of the genome codes for proteins.
9. Repeated sequences make up very large portion of the human genome. Repetitive sequences have no direct coding functions but they shed light on chromosome structure, dynamics and evolution (genetic diversity).
10. Chromosome 1 has 2968 genes, whereas chromosome ’Y’ has 231 genes.
11. Scientists have identified about 1.4 million locations, where single-base DNA differences (SNPs – Single nucleotide polymorphism – pronounce as ‘snips’) occur in humans. Identification of ‘SNIPS’ is helpful in finding chromosomal locations for disease-associated sequences and tracing human history.

Question 86.
Describe the principle involved in DNA fingerprinting technique.
Answer:
The DNA fingerprinting technique was first developed by Alec Jeffreys in 1985. The DNA of a person and finger prints are unique. There are 23 pairs of human chromosomes with 1.5 million pairs of genes. It is a well known fact that genes are segments of DNA that differ in the sequence of their nucleotides. Not all segments of DNA code for proteins, some DNA segments have a regulatory function, while others are intervening sequences (introns) and still others are repeated DNA sequences. In DNA fingerprinting, short repetitive nucleotide sequences are specific for a person. These nucleotide sequences are called as variable number tandem repeats (VNTR). The VNTRs of two persons generally show variations and are useful as genetic markers.

DNA fingerprinting involves identifying differences in some specific regions in the DNA sequence called repetitive DNA because in these sequences, a small stretch of DNA is repeated many times. These repetitive DNA are separated from bulk genomic DNA as different peaks during density gradient centrifugation. The bulk DNA forms a major peak and the other small peaks are referred to as satellite DNA. Depending on base composition (A: T rich or G : C rich), length of segment and number of repetitive units, the satellite DNA is classified into many subcategories such as micro-satellites and mini satellites, etc.

These sequences do not code for any proteins, but they form a large portion of human genome. These sequences show high degree of polymorphism and form the basis of DNA fingerprinting. DNA isolated from blood, hair, skin cells, or other genetic evidences left at the scene of a crime can be compared through VNTR patterns, with the DNA of a criminal suspect to determine guilt or innocence. VNTR patterns are also useful in establishing the identity of a homicide victim, either from DNA found as evidence or from the body itself.

Question 87.
Draw a flow chart depicting the steps of DNA finger printings technique
Answer:

Higher Order Thinking Skills (HOTs) Questions

Question 1.
An mRNA strand has a series of triplet codons of which the first three codons are given below
(a) AUG
(b) UUU
(c) UGC
(i) Name the amino acid encoded by these triplet codons.
(ii) Mention the DNA sequence from which these triplet codons would have transcribed?
Answer:
(i) AUG codes for Methionine
UUU codes for Phenylalanine
UGC codes for Cysteine
(ii) TAC sequence of DNA is transcribed to AUG
AAA sequence of DNA is transcribed to UUU
ACG sequence of DNA is transcribed to UGC

Question 2.
Given below are the structures of tRNA molecules which are involved in the translation process. In one tRNA, the codon is mentioned but not the amino acid. In another tRNA molecule, the amino acid is named and not the codon. Complete the figure by mentioning the respective amino acids and codons.
Answer:

Question 3.
A DNA fragment possesses 32 adenine bases and 32 cytosine bases. How many total numbers of nucleotides does that DNA fragment contain? Explain.
Answer:
128 nucleotides. Adenine always pairs Thymine base. If there are 32 adenine bases then there must be 32 Thymine bases. Similarly cytosine pairs with guanine. If cytosine bases are 32 in number the guanine bases will be equal to cytosine. So it makes a total of 128 nucleotides.

Question 4.
Following is a DNA sequence representing a part of the gene TAC TCG CCC TAT UAA CCC AAA ACC TCT using this derive A.

1. The RNA transcript
2. The spliced mRNA (consider all the codons with two Aderine bases are introns)
3. The total number of amino acids coded by the mRNA

Answer:

1. RNA transcript: AUG UGC GGG AUA GGG UUU UGG AGA
2. Spliced mRNA: AUG UGC GGG GGG UUU UGG
3. 6 amino acids are coded by mRNA

Question 5.
Complete the molecular processes by naming them

1. DNA → DNA
2. mRNA → Protein
3. RNA transcript → mRNA

Answer:

1. Replication
2. Translation
3. Splicing